Home > Sample essays > Exploring AMPK Signaling Pathway in Breast Cancer to Understand Obesity Risks

Essay: Exploring AMPK Signaling Pathway in Breast Cancer to Understand Obesity Risks

Essay details and download:

  • Subject area(s): Sample essays
  • Reading time: 13 minutes
  • Price: Free download
  • Published: 1 April 2019*
  • Last Modified: 23 July 2024
  • File format: Text
  • Words: 2,879 (approx)
  • Number of pages: 12 (approx)

Text preview of this essay:

This page of the essay has 2,879 words.



Expression pattern of  AMPK Signaling Pathway in Breast Cancer women in Relation to Obesity.

^Hassan, M.A., *Al-Sakkaf, K.A., ^Choudhry, H., ^Al-Malki,  A.

^Faculty of Science, *Faculty of Applied Medical Sciences, King Abdulaziz University.

Abstract

Epidemiological and experimental studies provide evidence that obesity predisposes people to cancer, and that tumor cells thrive and proliferate rapidly in this environment. In Saudi Arabia; the obesity and breast cancer are the main issues for the ministry of health.  The association between obesity and breast cancer and the underlying biology and mechanisms is less well understood. AMP-activated protein kinase (AMPK) is the critical cellular energy sensor and directly regulate glucose metabolism and insulin sensitivity. Therefore, we hypothesize that changes in the signaling pathways that control aspects of cellular energy associated with obesity may affect the risk of breast cancer. Circulating AMPK may serve as biomarkers in breast cancer and it has yet to be identified. We aim to understand the expression status of circulating AMPKα1 and it is up and down regulators stream genes LKB1, mTOR and P53 in 20 lean, 25 oversights and 47 obese breast cancer women subjects and correlated with personalizing characteristic and anthropometric parameters. We using RT-PCR for measured the expression levels of these genes. We found that low expression pattern of LKB1, AMPKα1 and P53 and high expression of mTOR in obese breast cancer women compared with lean breast cancer women. This may affect the levels of activated enzyme and accounts for its effect on breast cancer suppression. Therefore we suggest that strong association between obesity and breast cancer in Saudi Arabia. Moreover circulating AMPK gene expression was indicated as biomarkers for breast cancer diagnoses.

Introduction:

Cancer is a major human health problem, a group of diseases that cause death worldwide. Cancer is characterized by uncontrolled growth of abnormal cells to become tumor and spread to the other tissues (American cancer society 2015). Based on GLOBOCAN estimation, about 14.1 million new cancer cases were diagnosed, 8.2 million deaths and 32.6 million people living with cancer in 2012 worldwide; and more than half of these estimated numbers occurred in the less developed regions (Ferlay J et al. 2013). Breast cancer is the most commonly diagnosed cancers and leading cause of death among women worldwide. The incidence rates of breast cancer in women are increased in more developed regions compared with less developed regions, due to an association of the developed regions with a number of risk factors that could predispose breast cancer (Carol E. DeSantis et al. 2015 and Ferlay, J. et al. 2015).

In Saudi Arabia,  about 17.5 thousand new cancer cases and 9.1 thousand cancer deaths in both men and women in 2012 (Ferlay J et al. 2013). According to the National Cancer Registry in the Saudi Arabia; about 48% of cancer diagnosed were male and 52% were females (Al-Eid and Arteh 2014). Breast cancer was ranked top in incidence with high prevalence and mortality among females in Saudi Arabia; accounting for 30.3% breast cancer from all newly diagnosed female cancers in 2012 rather than 27.4% in 2010 and 25.1% in 2009 (Al-Eid and Arteh 2014 and Ferlay J et al. 2013).

Figure 1: Saudi Arabia incidence and mortality rates of cancer in women, as described in GLOBOCAN 2012 (Ferlay J et al. 2013).

Breast cancer is a complex, multifactorial disease with different biological and clinical characteristics (Pilar Eroles et al. 2012). There are many types of breast cancer; the most common one is the ductal carcinoma and the second most common is lobular carcinoma (National cancer institute). Numerous risk factors could be directly associated with breast cancer; like gender, age, family history, hormone use, dietary habits, alcohol intake, inactive lifestyle, diabetes, obesity and radiation exposure (S. Eva Singletary 2003). 5-10% of the total breast cancer cases might be inheritable, therefore; genetic risk factor such as mutations in genes including BRCA1, BRCA2, P53, CDH1, STK11, PTEN, CHEK2, PALB2, BRIP1 and ATM  significantly increase risk of breast cancer development (Shiovitz S and Korde LA. 2015; Apostolou P and Fostira F. 2013). Single-nucleotide polymorphisms (SNP), genes expression status also contributed to increasing risk of breast cancer and that lead to the initiation and progression of it. However, several other factors could predispose women to develop breast cancer such as menstrual periods, age of first childbirth or nulliparity and short duration of breastfeeding (Carol E. DeSantis et al. 2015; S. Eva Singletary 2003).

Obesity poses a serious public health issue in the worldwide and also in the Saudi Arabia.  According to WHO, there are more than 1.9 billion overweight adults; of these over 600 million were obese in 2014 worldwide (WHO 2014). In Saudi Arabia; the prevalence of obesity is 28.7% and the incidence is higher among women 33.5% compared to 24.1% in men (Memish ZA et al. 2014). Several epidemiological studies demonstrated a relationship between obesity, type II diabetes and breast cancer in postmenopausal women (Vona-Davis, L. and Rose, D.P. 2012; Vona-Davis, L.; Rose, D.P. 2007). This link result of  the; elevated the estrogens production by adipose tissue; also, a metabolic syndrome that results of increase levels of insulin and insulin-like growth factor I (IGF-1) and decrease adiponectin levels (David P. Rose et al. 2015; Grodin JM et al. 1973).

Obesity is strongly joined with type II diabetes, insulin resistance and increased circulating insulin levels, hence significantly increase breast cancer risk. Obese postmenopausal women with type II diabetes have a high accumulation of adipose tissue that leads to increasing level of free fatty acid  in circulation, which  increases an amount of glucose as results of up-regulation of glucose biosynthesis by gluconeogenesis. Subsequently; pancreas release insulin that leads to hyperinsulinemia. Insulin induces estrogens production from adipose tissue by regulated of adipose aromatase activity.  Aromatase; is a regulation point in estrogens biosynthesis that considerable as breast cancer risk (David P. Rose et al. 2015; Piotr J Wysocki and Bogna Wierusz-Wysocka  2010; Michels KB et al. 2003; Goodwin PJ et al. 2002 and Grodin JM et al. 1973).

AMP-activated protein kinase (AMPK) is heterotirmeric enzyme composed of a catalytic α subunit and regulatory subunits (β and γ) (David Stapleton et al. 1996). It is a vigilante of energy status, responding to decrease cellular energy and increase in the AMP:ATP or ADP/ATP ratio. The role of AMPK is to protect the cell from various physiological stresses, by switching off anabolic processes that highly energy consuming process such as cell division and proliferation, and induce catabolic pathway like glucose uptake, glycolysis and fatty acid oxidation that lead to increase cell energy status (Suter, M. et al. 2006). AMPK is activated by upstream protein kinases including calmodulin kinase kinase beta (CaMKKß), Tak1, LKB1, metformin, phenformin and exercise. (Sakamoto K et al. 2005 and Anderson, K.A. et al. 1998). AMPK is activated also by several hormones and cytokines and has a growing number of downstream targets as described in figure 2. Little is known of AMPK in cancer, though several lines of evidence suggest a highly important role, two of its known upstream regulators, LKB1 and CaMKKß, are gaining recognition as tumor suppressors (In Young Kim and Yu-Ying He 2013).  

Figure 2: Activation and downstream targets of AMPK (from InYoung Kim and Yu-Ying He 2013)

Study Problem:

A number of studies have reported an association between obesity and breast cancer in women worldwide. However; up to date there are no studies which carried these association in women from Saudi Arabia. AMPK and it is a signaling pathway genes biomarkers in obesity and breast cancer have yet to be identified. In addition, there is no publish data on whether the obesity and breast cancer are linked to AMPK and it is a signaling pathway genes as well as some key biochemical markers. Therefore, the aim of this study was to investigated for the association between obesity and AMPK and it is a signaling pathway genes, in breast cancer initiation and development.

Objective:

The objectives of this study included:

• Measured and screened the expression levels of AMPKα1 and up and downstream genes in women breast cancer of the west provision of Saudi Arabia.

• Determined the molecular mechanism  and association between obesity and breast cancer in women of the west provision of Saudi Arabia.

• To correlated the AMPK and it is a signaling pathway genes with the baseline characteristic and anthropometric parameters and prognostic indicators for breast cancer.

Materials and Methods:

The study was conducted in collaboration with the Unit of Mammography, Department of Radiography. It has been done in accordance with the guidelines set by the ethical committee of King Abdulaziz University Hospital, Jeddah, Saudi Arabia.  

Subjects

The study population included 92 women patients attending the Unit of Mammography where they are diagnosed with breast cancer. Volunteers asked to sign a consent form indicating their willingness to participate in the study. Furthermore, all subjects completed a general questionnaire that includes essential patient information. The anthropometric measurements have been collected using standard well-established methods. The body mass index (BMI) were calculated by weight (kg)/height (m2) formula and used as index according to WHO to classify subjects to lean (BMI<25), overweight (25≤BMI<30) and obese (BMI≥30). The clinical interpretation data have been provided by the consultants, radiologist and the pathologist.

Blood Samples Collection:

Blood samples were collected from recruited diagnosed breast cancer women patients by a qualified nurse. From any participants, 2.5 ml of blood sample were in PAXgene™ blood RNA tubes (PreAnalytiX, Hombrechtikon, Switzerland) and lifted at room temperature for two hours and then stored at -80°C until use.

Isolation of total RNA:

Total cellular RNA was isolated from the samples with the PAXgeneTM blood RNA kit (Qiagen, UK) following the manufacturer’s protocols. The concentration of total RNA was measured using a spectrophotometer. The quality of RNA was analyzed by a 1.2% formaldehyde-agarose gel electrophoresis. Only samples that have good quality and quantity RNA were used in this study.

Primer design and order:

Primers were designed to measure the expression of AMPK, LKB1, mTOR, P53 as well as GAPDH as endogenous control gene using the publically available primer3 web tool (http://frodo.wi.mit.edu/). To ensure specific primer design and avoided amplification of non-target products, each designed primer was assessed using the silico PCR tool provided by the UCSC Genome Browser (http://genome.ucsc.edu/cgi-bin/hgPcr?command=start). Specific primers for each of the target transcript predesigned were ordered from Integrated Device Technology (USA).  The PCR primers sequences were showing in table 1.

Table 1: Forward and reverse PCR primers sequences

# Primers name Forward sequence (5′ to 3′) Reverse sequence (5′ to 3′)

1 AMPKα1 (2) GTAGTAAAAACAGGCTCCACGAA CACCAGAAAGGATCTGTTGGA

2 LKB GAGAAGCGTTTCCCAGTGTG CCCAGGTCGGAGATTTTGA

3 P53 GGCTCTGACTGTACCACCAT GATTCTCTTCCTCTGTGCGC

4 mTOR TATGACCCCAACCAGCCAAT GAGATGTTGGGTCATTGGCC

5 GABDH TCACCAGGGCTGCTTTTAAC GATGATCTTGAGGCTGTTGTCA

Quantitative Real-time Polymerase Chain Reaction (qPCR):

To validate the relative expression levels of transcripts in patients, cDNA were synthesized using the QuantiTect Reverse Transcription Kit (Qiagen, UK) for reverse transcription. Alternatively, a combination of multiple internal control genes may be used for normalization. Amplifications have been performed in duplicate using Bio-Rad IQ SYBR Green Mix (Bio-Rad) in the CFX Connect™ Real-Time PCR Detection System (Bio-Rad, USA), and methods performed as detailed in the manufacturer’s instruction. Relative expression quantification was calculated by using -2ΔΔCT method (Livak KJ and Schmittgen TD. 2001) and normalized with GAPDH as an internal control.

Statistical analysis:

Statistical analyses were performed by SPSS version 15.0 software. Results were express as mean ± S.D. If probability (p) < 0.05 it was taken as significant.

Results:

Baseline characteristic and anthropometric parameters

The baseline characteristics of subjects participant in the study are summarized in table 2. The total number of samples were 92 obese breast cancer women that distributed to 54.3 % Saudis rather than 45.7% non-Saudi and they had school educational level or illiterate. About marital status, most participants were married and have more than one children. About 73% of the subjects had breastfed her children. The first menstruation age was from 12-15 years with average (13.36±1.54). 54.3% of the volunteers were menopause with the average age (50.30±6.06). Most participants weren’t  smoking and a physical activate. About family history, most of the participants don’t  have a family history of breast cancer or other cancers.

Table 2: Baseline characteristics of subjects participating in the study

Parameters N (%) Average ± SD (SEM)

Marital Status Single 10 (10.9)

Married 78 (84.8)

Divorce 4 (4.3)

Educational level Illiterate 21 (23.3)

School 37 (41.1)

First degree 11 (12.2)

Higher degree 21 (23.3)

Nationality Saudi 50 (54.3)

Non Saudi 42 (45.7)

Age of first menstruation ˂ 12 Years 6 (6.5) 13.36±1.54

(0.16)

12-15 Years 81 (88)

> 15 Years 5 (5.4)

Menopause Yes 50 (54.3)

No 42 (45.7)

Age of menopause ˂ 48 Years 13 (27.7) 50.30±6.06

(0.89)

48-55 Years 27 (57.4)

> 55 Years 7 (14.9)

No. of children None 6 (6.9) 4.24±2.80

(0.30)

3 or less 36 (41.4)

4 to 6 27 (31)

more than 6 18 (20.7)

Age of pregnancy ≤ 20 Years 33 (40.7) 22.37±4.90

(0.54)

21-30 Years 43 (53.1)

> 30 Years 5 (6.2)

Breast feeding Never 15 (16.9)

Yes 65 (73)

only some 9 (10.1)

Family history of breast cancer Yes 17 (18.9)

No 73 (81.1)

Family history of other cancer   Yes 15 (16.7)

No 75 (83.3)

Diabetes mellitus status Yes 19 (21.3)

No 72 (78.7)

Physical activities performance Yes 31 (34.1)

No 60 (65.9)

Smoking Yes 5 (5.4)

No 87 (94.6)

Do you think that your diet is rich in fat Yes 24 (26.1)

No 68 (73.9)

Data presented as total number (%)

Among anthropometric parameters of subjects that were provided in table 3. The total number of samples were 92 of the breast cancer women. The mean age of those was (51.14±11.71), BMI (30.69±8.41) and W/H (0.87±0.08). From  total subjects, 21% have normal BMI, and the prevalence of overweight and obese were 27.2% and 51.1% respectively.

Table 3: Anthropometric parameters of subjects participating in the study

Parameters Total Lean Overweight Obese

N (%) 92 (100) 20 (21.7) 25 (27.2) 47 (51.1)

Age (years) 51.14±11.71 (1.22) 47.80± 7.35 (1.64) 47.04±9.18 (1.84) 54.74±13.33 (1.94)

BMI kg/m2 30.69±8.41 (0.88) 22.69±2.30 (0.54) 27.63±1.06 (0.21) 35.30±9.42 (1.37)

Waist circumference (cm) 91.20±21.49 (2.24) 78.13±12.73 (2.85) 93.39±27.0 (5.4) 95.62±19.22 (2.80)

Hip  circumference (cm) 105.43±22.19 (2.31) 93.85±15.86 (3.55) 107.68±25.6 (5.12) 109.17±21.28 (3.10)

Waist-hip Ratio 0.87±0.08 (0.01) 0.84±0.07 (0.01) 0.86±0.09 (0.02) 0.88±0.08 (0.01)

Data presented as Mean ± SD (SEM), N=number of samples

RNA extraction and expression

Total RAN was extracted from peripheral blood. The concentration of extracted RNA was in average (155.49 ng/ul) and the purity was showed in the range of 1.9-2.1 by measuring the optical density at 260/280 nm ratio.

We designed the experiment to determine a signature of AMPK and it is s signaling pathways genes in peripherals blood of breast cancer women and identify the effect of obesity to initiation and progression of breast cancer. Interestingly, among the relative expression of the genes were presented in figure 3, we found that a down-regulation of AMPKα1 expression (-1.5 fold) was detected in samples of obese comparing with lean samples. In addition, wild-type P53 was (-1.32 fold) down-regulated in obese and up-regulated in overweight (1.31 fold) comparing with lean subjects. Furthermore, mTOR has been the opposite expression pattern and it was down-regulated in overweight (-1.33 fold) and highly regulated in obese compared with lean subjected.

Figure 3: Relative expression of the genes in lean, overweight and obese breast cancer women.

Discussion:

AMPK is heterotirmeric enzyme composed of a catalytic α subunit and regulatory subunits (β and γ) (David Stapleton et al. 1996). It is a vigilante of energy status, responding to decrease cellular energy and increase in the AMP:ATP or ADP/ATP ratio. The role of AMPK is to protect the cell from various physiological stresses, by switching off anabolic processes that highly energy consuming process, and induce catabolic pathway that leads to increasing cell energy status (Suter, M. et al. 2006). AMPK is activated by upstream protein kinases and it has a growing number of downstream targets that described in figure 2.

Little is known of AMPK in cancer, though several lines of evidence suggest a highly important role, two of its known upstream regulators, LKB1 and CaMKKß, are gaining recognition as tumor suppressors (In Young Kim and Yu-Ying He 2013).  In our  present study, we measured the expression level of AMPKα1 and  LKB1 as up-regulated and mTOR and P53 as downstream effects of AMPK in obese and non-obese breast cancer women to investigate the relationship between obesity and breast cancer. We found that different expression pattern for these genes. We found that low expression pattern of LKB1, AMPK α1 and P53 and high expression of mTOR in obese breast cancer women compared with lean breast cancer women. Our results were closely related with the hypotheses about AMPK signalling pathway that showed in figure 2. In our obese subjects, low expression of LKB1 lead to down-regulation of AMPK gene which have negative effects on mTOR expression. mTOR has opposite effects against apoptosis pathway and we indicated that by low expression of p53tuomer suppressor gene.

Conclusion:

These results suggest a decrease expression of AMPKα1 and wild-type P53 and increase the mTOR expression in obese patients. This may affect the levels of activated enzyme and accounts for its effect on breast cancer suppression. Therefore we suggest that strong association between obesity and breast cancer in Saudi Arabia. Moreover circulating AMPK gene expression was indicated as biomarkers for breast cancer diagnoses.

Future work:

lncRNAa serve as biomarkers in a lot of human diseases. However, lncRNA biomarkers in obesity and related to breast cancer have yet to be identified. Therefore, the future works for our team will be doing more experiment to determine the expression levels of lncRNAs to exploring new biomarkers for obesity and breast cancer and relationship with them. Also we will knockdown of the significant genes to determine the mechanisms and pathway know the ways that joined that gene with diseases. Furthermore, we will measure the cell proliferation and  cell death by cell proliferation and cell apoptosis assay respectively.

Acknowledgements

This project was funded by the National Plan for Science, Technology and Innovation (MAARIFAH) – King Abdulaziz City for Science and Technology – the Kingdom of Saudi Arabia – award number (10-BIO-1255-03). The authors also acknowledge with thanks, King Fahad Medical Research Center at KAU in Jeddah for providing material and labs and apparatus for this research to be done.

References:

• Al-Eid, Haya S and Arteh, SO. Cancer Incidence Report Saudi Arabia 2010. Riyadh: Kingdom of Saudi Arabia Ministry of Health National Cancer Registry 2014.

• American Cancer Society. Cancer Facts & Figures 2015. Atlanta: American Cancer Society; 2015

• American cancer society: Breast Cancer. Available from: http://www.cancer.org/cancer/breastcancer/. Last accessed 3 Jan 2016.

• Anderson, K.A., Means, R.L., Huang, Q.H., Kemp, B.E., et al. Components of a calmodulin-dependent protein kinase cascade. Molecular cloning, functional characterization and cellular localization of Ca2+ /calmodulin-dependent protein kinase kinase beta. J. Biol. Chem. 1998; 273, 31880–31889.

• Apostolou P, Fostira F. Hereditary breast cancer: the era of new susceptibility genes. Biomed Res Int. Epub 2013; Mar 21. Review.

• Carol E. DeSantis, Freddie Bray, et al. International Variation in Female Breast Cancer Incidence and Mortality Rates. Cancer Epidemiol Biomarkers Prev October 2015; 24:1435.

• David P. Rose, Peter J. Gracheck  and Linda Vona-Davis. The Interactions of Obesity, Inflammation and Insulin Resistance in Breast Cancer. Cancers 2015; 7, 2147–2168.

• David Stapleton, Ken I. Mitchelhill, Guang Gao,Jane Widmer, et al.. Mammalian AMP-activated Protein Kinase Subfamily. The Journal of Biological Chemistry 1996; Vol. 271, No. 2, Issue of January 12, pp. 611–614.

• Ferlay, J., I. Soerjomataram, et al. “Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012.” Int J Cancer 2015; 136(5): E359-386.

• Ferlay J, Soerjomataram I, Ervik M, Dikshit R, Eser S, Mathers C, Rebelo M, Parkin DM, Forman D, Bray, F. GLOBOCAN 2012 v1.0, Cancer Incidence and Mortality Worldwide: IARC CancerBase No. 11 [Internet]. Lyon, France: International Agency for Research on Cancer; 2013. Available from: http://globocan.iarc.fr, accessed on 1/Jan/2016.

• Goodwin PJ, Ennis M, Pritchard KI et al. Fasting insulin and outcome in early-stage breast cancer: results of a prospective cohort study. J. Clin. Oncol. 2002; 20(1), 42–51.

• Grodin JM, Siiteri PK, MacDonald PC. Source of estrogen production in postmenopausal women. J. Clin. Endocrinol. Metab 1973; 36(2), 207–214.

• In Young Kim and Yu-Ying He. Targeting the AMP-activated protein kinase for cancer prevention and therapy. Front Oncol. 2013 Jul; 15; 3:175.

• Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001 Dec;25(4):402-8.

• Memish ZA, El Bcheraoui C, Tuffaha M, Robinson M, Daoud F, Jaber S, et al. Obesity and Associated Factors — Kingdom of Saudi Arabia, 2013. Prev Chronic Dis 2014; 11:140236.

• Michels KB, Solomon CG, Hu FB et al. Type 2 diabetes and subsequent incidence of breast cancer in the Nurses’ Health Study. Diabetes Care 2003; 26(6), 1752–1758.

• National Cancer Institute: What You Need To Know About Breast Cancer. Available at (http://www.cancer.gov/publications/patient-education/wyntk-breast-cancer). Last accessed 3 Jan 2016.

• Pilar Eroles, Ana Bosch, et al. Molecular biology in breast cancer: Intrinsic subtypes and signaling pathways. Cancer Treatment Reviews 2012; 38: 698–707

• Piotr J Wysocki and Bogna Wierusz-Wysocka. Obesity, hyperinsulinemia and breast cancer: novel targets and a novel role for metformin, Expert Review of Molecular Diagnostics 2010; 10:4, 509-519.

• S. Eva Singletary. Rating the Risk Factors for Breast Cancer. ANNALS OF SURGERY 2003; Vol. 237, No. 4, 474–482.

• Sakamoto K, McCarthy A, Smith D et al. Deficiency of LKB1 in skeletal muscle prevents AMPK activation and glucose uptake during contraction. EMBO J. 2005; 24(10), 1810–1820.

• Shiovitz S and Korde LA. Genetics of breast cancer: a topic in evolution. Annals of Oncology Jul 2015; 26(7):1291-9.

• Suter, M., Riek, U., Tuerk, R., Schlattner, U., Wallimann, T. And Neumann, D. Dissecting the role of 5’-AMP for allosteric stimulation, activation, and deactivation of AMP-activated protein kinase. J. Biol. Chem. 2006; 281, 32207–32216.

• Vona-Davis, L.; Rose, D.P. Adipokines as endocrine, paracrine, and autocrine factors in breast cancer risk and progression. Endocr. Relat. Cancer 2007; 14, 189–206.

• Vona-Davis, L.; Rose, D.P. Type 2 diabetes and obesity metabolic interactions: Common factors for breast cancer risk and novel approaches to prevention and therapy. Curr. Diabetes Rev. 2012; 8, 116–130.

• World Health Organization. Global health observatory data repository. 2014. Overweight and obesity. Available from: http://www.who.int/gho/ncd/risk_factors/overweight_text/en/. Last accessed 12 Jan. 2016.

About this essay:

If you use part of this page in your own work, you need to provide a citation, as follows:

Essay Sauce, Exploring AMPK Signaling Pathway in Breast Cancer to Understand Obesity Risks. Available from:<https://www.essaysauce.com/sample-essays/2016-11-20-1479632303/> [Accessed 22-04-26].

These Sample essays have been submitted to us by students in order to help you with your studies.

* This essay may have been previously published on EssaySauce.com and/or Essay.uk.com at an earlier date than indicated.