Gemcitabine Chemoresistance Contention of microRNA-608 through Regulation of RRM1 and CDA in Pancreatic Cancer Cell Lines
Keywords: microRNAs, pancreatic neoplasms, gemcitabine resistance, RRM1, CDA
Abstract
Gemcitabine-based treatment is the traditional chemotherapy for pancreatic cancer (PC); however, PC patients still cope with real therapeutic difficulties. The aim of this study was the identification of relationship between expression level of RRM1, CDA and miR-608 in gemcitabine resistant cell lines and parental cell lines. We performed dual luciferase assay to determine whether both RRM1 and CDA are direct miR-608 targets in pancreatic cancer cell lines. Then, in order to study the relationship between expression level of RRM1, CDA and miR-608 in resistant cell lines, we measured their expression level by quantitative real-time reverse transcription–polymerase chain reaction after continuous exposure of pancreatic cancer cell lines to gradually increasing concentration of gemcitabine. Also, we performed qPCR analysis after transient transfection of MIA PaCa-2 and AsPC-1 cells with pCDNA 3.1+ vector containing precursor of miR-608 and/or scrambled miRNA normalized to the cells transfected with pCDNA 3.1+ vector. Luciferase assay results showed that rrm1 and cda could be the targets of miR-608. Compared to parental cell lines, gemcitabine resistant cells showed higher expression of rrm1 (P = .0067), cda (P=.003), and lower expression of miR-608 (P=.0003). Furthermore, in transfected MIA PaCa-2 and AsPC-1 cell lines, decreased expression of rrm1 and cda was observed (by 53% and 59%, respectively) compared to transfected cells with scrambled microRNA. In conclusion, the findings of this research demonstrated that quantitative analyses of rrm1, cda and miR-608 levels may be useful in predicting the gemcitabine responsiveness of pancreatic cancer cell lines.
Introduction:
Pancreatic adenocarcinoma is one of the most malignant human solid tumors [1]. Only in about 20% of the patients could surgical resection be effective because the disease is diagnosed in advanced or metastatic steps. Due to the high incidence of recurrence, only 15-25% of patients have 5-year survival [2]. Among the few available therapeutic options, gemcitabine (GEM) is the most popular approach in treatment of pancreatic cancer. Nevertheless, there are still therapeutic challenges because of high degree of inherent and acquired chemoresistance [3, 4]. Inherent chemoresistance is rather due to the impervious nature of pancreatic cancer cells and hypoxic microenvironment reducing the penetration and delivery of chemotherapeutic drugs [5]. Even in cases that respond to gemcitabine to some extent, a number of patients show resistance traits soon after initiation of chemotherapy [6].
Several studies have analyzed the underlying mechanisms of chemoresistance in pancreatic cancer. These mechanisms include evasion from apoptosis through processing of drug-induced damage [7], changes in the genes playing the role of drug transporters [8], metabolizing enzymes [9] and drug targets [10]. However, they still remain controversial because there is no direct evidence based on either in vitro gene transfer model systems or clinical data from patients with pancreatic cancer.
The large subunit of ribonucleotide reductase M1 (RRM1) multimeric enzyme converts the ribonucleoside diphosphates to deoxyribonucleoside diphosphates essential for DNA synthesis [11]. Ribonucleotide reductase increases the deoxynucleoside triphosphate (dNTP) pool in the cells, which could lead to lowered insertion of dNTP analogues like triphosphorylated gemcitabine into DNA, leading to reduced antitumor activity of gemcitabine [12]. Upregulation of rrm1 as a target of gemcitabine has been implicated in gemcitabine resistance phenomenon [13]. So, the study of genetic variants and mRNA expression levels has been established as a prognostic marker in different types of malignancies, including pancreatic, breast, non-small-cell lung and biliary tract cancer [14].
Cytidine deaminase (CDA) is an enzyme metabolizing the majority of administered gemcitabine to inactive form of 2’2’-difluorodeoxyuridine (dFdU) [15]. The highly polymorphic nature of the gene encoding for CDA results in various functional enzymatic activities significantly associated with differential sensitivity to gemcitabine. For instance, reduced enzyme activity was shown in pancreatic cancer patients carrying CDA 79A>C (Lys27Gln) SNPs [16]. Also, high expression levels of CDA in advanced pancreatic cancer patients treated with gemcitabine were associated with a delayed time to progression and drug resistance [17].
Evaluation of the influence of microRNAs (miRNA or miR) on drug action is another field for drug resistance researches [18]. MicroRNAs (miRNAs) belong to a small noncoding RNA molecule family composed of 21 to 23 nucleotides playing important roles in post transcriptional control of gene expression. Currently, 1600 human miRNAs have been identified (miRBase21, http:// www.mirbase.org/). MiRNAs are predicted to control the activity of many protein-coding genes in mammals. MiRNA pharmacogenomics states that overexpression of a specific miRNA downregulates the genes encoding proteins that promote drug efficacy. On the other hand, decreased miRNA levels may lead to upregulation of the genes that inhibit drug function. Both these processes may change drug function and therefore make miRNAs indirect, potent regulators of drug action [20]. It is assumed that each miRNA can regulate several messenger RNAs. Despite the fact that many computational analyses have demonstrated multiple-to-multiple relationships between miRNAs and their targets, few studies have experimentally examined this relevance in vivo/vitro [21].
Up to now, some studies have proven the role of miRNAs in gemcitabine resistance, including miR-15a [22], miR-21 [23], miR-34 [24], miR-200b and miR-200c [25], miR-214 [22], miR-221 [26] as well as some members of the let7 family [25]. However, it seems that the study of miRNAs with common target genes is still unfledged. Since both rrm1 and cda account for gemcitabine resistance predictive markers, we hypothesized that the expression of microRNAs commonly regulating both genes would affect the viability of pancreatic cancer cell line treated with gemcitabine. In the current study, we developed gemcitabine-resistant cells from human pancreatic cancer cell lines and performed comparative studies on the expression level of rrm1 and cda as well as their commonly targeting miRNA (miR-608).
Materials and Methods
Cell lines and establishment of gemcitabine-resistant cells
MIA PaCa-2 and AsPC-1 human PC cell lines were acquired from National Cell Bank of Iran (Pasteur Institute of Iran). The M PaCa-2 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Life Technology, 12100046) and AsPC-1 cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Life Technology, 11875119). The media were enriched with 10% heat-inactivated fetal bovine serum (Life Technology, 1600044), L-glutamine and antibiotics (100 units/mL of penicillin and 100 μg/mL of streptomycin). The cells were maintained at 37°C in 5% CO2. Gemcitabine was obtained from Eli Lilly (Italy).
For establishment of gemcitabine-resistant cells, we gradually adapted the cells to gemcitabine through exposing them to increasing concentrations of the drug. For this purpose, the cell lines were treated with 80% of LC50 gemcitabine concentration for at least 14 days. Then, the medium was replaced with fresh medium containing no gemcitabine, and RNA was isolated after the cells reached proper confluency. Afterwards, based on the next MTT assay results, we performed the next treatment step. In the experiments, the following schedules were applied for gemcitabine treatment in the two cell lines according to their 80% of LC50: (a) MIA PaCa-2: 10, 15, 25 and 40 μM (b) AsPC-1:25 and 35 μM then fresh drug-free medium. RNA isolation was performed at the end of each treatment period. Five MIA PaCa2 clones including untreated and four treated clones containing MIA PaCa2-S, MIA PaCa2-RG1, MIA PaCa2-RG2, MIA PaCa2-RG3, and MIA-PaCa2-RG4 and two treated AsPC-1 clones including AsPC-1-RG1 and AsPC-1-RG2 were used in these experiments compared to untreated cell lines.
Chemosensitivity testing using MTT assay
Cell proliferation assay was performed using 3-(4, 5-dimethylthiazole-2-yl)-2, 5-biphenyl tetrazolium bromide (MTT) (Sigma, M2128). MIA PaCa-2 and AsPC-1 cells were added to 96-well tissue culture plates (1×104 cells/well) overnight and exposed to increasing concentrations (102 -103 nM) of gemcitabine for 72 hours. After 72 hours, the cells were incubated with MTT (500 μg/mL) for 5 hours. Then, the supernatants were removed and insoluble formazan was dissolved by isopropanol. Chemosensitivity was expressed as the drug concentration inhibiting cell proliferation by 50% (LC50 values) and was determined from concentration effect relationship. The absorbance (540 nm) was directly proportional to the number of living cells in culture. The absorbance at 570 nm was quantified on a spectrophotometer (reference wavelength: 630 nm) and the cell viability was defined relative to untreated control cells. The average results of repeated experiments were considered as reported results. Also, 48 hours after transfection of MIA PaCa-2 and AsPC-1 cells with miR-608 or scrambled containing pCDNA3.1+ vector, we performed MTT assay using drug concentrations of first step MTT.
RNA isolation and cDNA synthesis
Total RNA containing small RNAs was isolated from MIA PaCa-2 and AsPC-1 after each period of drug treatment step using TRIzol Reagent (Life Technologies) according to supplier’s instructions. Extraction was performed in MIA PaCa-2 and AsPC-1 after transfection with each precursor microRNAs (608, or scrambled miR). RNA concentration was assessed using a spectrophotometer (IMPLEN).
CDNA was synthesized by M-MuLV reverse transcriptase enzyme with 1 μg RNA using the cDNA synthesis kit (Fermentas, EP0351) according to supplier’s instructions. For microRNA cDNA synthesis, special stem loop of each miRNA was used. For negative controls, we used 2 samples of RNA to which no reverse transcriptase was added.
Real-time quantitative RT-PCR for analysis of mRNA and miRNA expression level
Duplicate qRT-PCR assays were carried out in a StepOnePlus TM Real-Time PCR System (Applied Biosystems) with SYBR Green PCR Master Mix (Takara) for mRNAs and TaqMan Master Mix (Takara) for miRNAs. GAPDH was used as an internal reference gene. The expression of target miRNA was also normalized relative to that of the endogenous control (RNU48). The primers used for qPCR reactions are as follows: rrm1 forward (5’-ACATCCACATTGCTGAGCCTAAC -3’) and reverse (5’-CATTAGCCGCTGGTCTTGTCC-3’), cda forward (5’-TGCTATCGCCAGTGACATGC-3’) reverse (5’- ATCCGGCTTGGTCATGTACAC-3’).
The forward primer used for miR-608 contained nucleotide of 5’-CAGTGTACAAGGGGTGGTGTT-3’and reverse primer included 5’- AGCTTAGACTACACCT GTCC GG -3’and 5'- -3' as probe. The products of reverse transcription were diluted (1:5) and one of them was used for real-time PCR. Then, PCR was done in 10 μl volume including 1 μl RT product, 1μl TaqMan universal PCR Master Mix (Takara, #RR420A), 0.2 μM Taq- Man probe, 0.7 μM of both forward primer and reverse primer. The reactions were incubated at 95°C for 10 min, followed by 40 cycles of denaturing at 95°C for 30 s, annealing at 60°C for 40 s and extension at 72°C for 1 min. The threshold cycle (CT) is defined as the fractional cycle number at which the fluorescence passes the fixed threshold. TaqMan CT values were converted into absolute copy numbers using a standard curve from synthetic U47 miRNA. A standard curve containing 4 dilution points was measured in triplicate. All PCR assays displayed efficiencies between 1.8 and 2.0.
MicroRNA transfections
PCDNA 3.1+ vector bearing precursor of miRNAs (pre-miR) including pre-miR-608 or control pre-miR precursor (scrambled) were purchased from Generay Biotechnology. About 106 Mia PaCa-2 and AsPC-1 cells was seeded in each well of a 6-well plate one day before transfection. When the confluence of the cells reached to 80%, they were transfected with 100 nM of vector according to manufacturer protocol of calcium phosphate. After 6 h, we substituted the transfection medium with fresh medium containing 15% FBS. The transfected cell lines were harvested 24, 48, and 72 hours post-transfection.
Construction of luciferase reporter plasmids and evaluation of luciferase activity
To make rrm1 3’UTRs reporter vector, 3′-UTR of rrm1 containing the miR-608 recognition site (region 5079–5400, in NM_001033.3) and cda (region 5079–5400, in NM_001785.2) were amplified using the following primers: rrm1 GCGATCGCGGAAAGACTTGGAAGAGACC (forward), and CTCGAG TATTTCAGAATAACCTTATAGG (reverse), cda GCGATCGCTATTGTCATGACGGTCCAG (forward) and CTCGAG TGATCCAG GATGTTCTGTG (reverse). PCR was performed in a total volume of 25 μL with 100 ng of genomic DNA, 10 pmol of each primer, 2 mMMgCl2, 200 mM dNTP, and 1.5 unit Pfu polymerase (Fermentas, EP0501) according to the following program: 95°C for 5 min; and 30 cycles of 95°C for 1 min, 61°C for 30 s, 72°C for 1 min, and final extension in 72°C for 10 min. After Taq polymerase treatment (Cinnagen), the PCR product was located into XhoI and sgfI position of pTZ57R/T multiple cloning site (Fermentas, K1214). To confirm the insertion of PCR product, colony-PCR reaction was performed with M13 forward and reverse primers. The product was then digested out from T vector with sgfI (Promega, R1851) and XhoI (Fermentas, ER0691) and inserted into psiCHECK™-2 vector (Promega, C8021) downstream to the stop codon of renilla luciferase gene. The constructed plasmids were examined by DNA sequencing analysis to prove nucleotide sequences. Luciferase assays were carried out with Dual-Glo® Luciferase Assay System (Promega, E2940). Then, about 4–5 × 104 MIA PaCa-2 and AsPC-1 cells were plated into each well of a 48-well plate. The day after, the cells were transfected with 400 ng psiCHECK™-2 vector containing RRM1 or CDA 3′-UTR and 100 nM of each precursor miRs (608 or scrambled miRs) using calcium phosphate protocol according to the manufacturer’s instructions. Luciferase activities were measured 24 and 48 hours after transfection using dual luciferase reporter assay system. The multi well plate luminometer Renilla luciferase activity was normalized to that of firefly luciferase.
Statistical methods
All the experiments were repeated at least three times. Results are expressed as mean ± standard error (SE). To evaluate possible significant differences in mRNA expression in each group, SPSS software (version 20, SPSS, Inc., Chicago, IL) was used for analysis of variance (ANOVA). Differences between variables were analyzed with subsequent post hoc Tukey test for sub group comparison. P value < 0.05 was considered statistically significant.
Results
Characteristics of established gemcitabine resistant cells
Establishment of resistance to gemcitabine was achieved by continuous and gradual exposure to gemcitabine. Initial doses were below LC50 (ASPC-1 LC50 = 30 μM and MiaPaCa-2 LC50 = 15 μM) and exposure was continued by increasing the drug doses. MTT assay and RNA extraction (see below) was carried out in each dose until the resistant clones survived in presence of gemcitabine dose higher than LC50 (Figure 1). Ultimate dose for MiaPaCa-2 and ASPC-1 cells was 40 μM and 35 μM, respectively. Although MiaPaCa-2 cells tolerated a higher concentration of gemcitabine, the difference was not statistically significant.
Expression level of RRM1 and CDA was significantly higher in gemcitabine resistant clones than in parental cells
Several mechanisms for gemcitabine resistance phenotype have been proposed, including activation of RRM1 and CDA genes (6, 7). To detect the alteration in expression level of RRM1 and CDA genes, the expression of both genes was analyzed at mRNA level using QRT-PCR in each does of gemcitabine. Consistent with the previous report, both genes showed an upregulation trend in each dose compared to sensitive cells (P≤0.05) (Figure 2). Overexpression of CDA and RRM1 seems to be correlated with the appearance of pancreatic resistant clones.
3ʹUTR of RRM1 gene has complementary sequence for miR-608
100 To identify the putative miRNAs targeting 3’UTR of RRM1 gene, an in silico approach was used, which was a combination of bioinformatic algorithms. The databases included TargetScan 4.0 (http ://www.targetscan.org/), Microcosm (http:// www.ebi.ac.uk/enright-srv/ microcosm/ htdocs /targets/ v5/ ), miRanda (http://www.microrna.org/microrna/searchMirnas.do), PicTar (http://www.pictar.mdc-berlin.de/), and DIANA-microT (http://www.microrna.gr/webServer), which are dedicated to miRNA target prediction and functional analysis. As shown in Figure 2, miR-608 has four complementary sequences in 3′UTR of CDA gene and one in RRM1, respectively.
MiR-608 is downregulated in gemcitabine resistant clone
Since bioinformatic analysis showed that miR-608 has complementary sequences in 3′UTR of RRM1 and CDA genes and these genes are upregulated in resistant cells, downregulation of miR-608 is likely to be a necessary step for resistance to gemcitabine. In this regard, the expression level of miR-608 was measured in each dose. Interestingly, in each dose, resistant clones showed lower miR-608 level compared to sensitive cells and this expression pattern was correlated with overexpression of RRM1 and CDA (Figure 2) (P≤0.05).
Overexpression of miR-608 was reversely correlated with downregulation of RRM1 and CDA genes
In order to investigate the association between miR-608 expression with RRM1 and CDA levels, a gain-of-function survey was carried out. A vector bearing miR-608 gene was transfected into pancreatic cell lines and the expression level of RRM1 and CDA genes was examined. As Figure 3 shows, overexpression of miR-608 is significantly correlated with downregulation of both target genes (P≤0.05). These results show that miR-608 upregulation causes downregulation of RRM1 and CDA in pancreatic cancerous cells probably due to direct targeting of these genes.
RRM1 and CDA genes are imminent targets of miR-608
To confirm that RRM1 and CDA genes are direct targets of miR-608, 3′UTR of RRM1 and CDA genes were cloned downstream of luciferase genes and co-transfected with miR-608 overexpressed plasmid. For negative control, a mutated seed sequence of miR-608 was used. As shown in Figure 4, co-transfection of miR-608 with psiCHECK vectors harboring 3′UTR of target genes resulted in reduced expression of reporter genes compared to control group. These results are in line with our bioinformatic and gene expression results and validate RRM1 and CDA as direct targets of miR-608.
MiR-608 increases sensitivity to gemcitabine in resistant clones
In order to identify the effect of miR-608 on resistance to gemcitabine, both cell lines were transfected with a plasmid bearing miR-608 and were then treated with gemcitabine. For control group, the cells were only treated with a gemcitabine dose. Proliferation and cell growth were evaluated via MTT assay after 24 hours. As shown in Figure 5, upregulation of miR-608 decreases the growth and proliferation ability of resistant clones compared to clones with a normal level of miR-608. These results suggest that miR-608 acts as a tumor-suppressor-miR and reverses the resistance to gemcitabine through downregulation of RRM1 and CDA genes.
In order to identify the effect of miR-608 on resistance to gemcitabine, the resistant clones were transfected with a plasmid bearing miR-608 and cell proliferation and growth was evaluated via MTT assay. As shown in Figure 5, upregulation of miR-608 decreases the growth and proliferation ability of resistant clones compared to clones with a normal level of miR-608. These results suggest that miR-608 acts as a tumor-suppressor-miR and reverses the resistance to gemcitabine through downregulation of RRM1 and CDA genes.
Discussion
Pancreatic cancer is the most lethal of all solid tumors because of its resistance to common therapies. While few patients response to gemcitabine, most became resistant to gemcitabine (6). Although several mechanisms have been purposed for emerging resistant phenotypes, the exact underlying mechanisms of gemcitabine resistance are still unknown. It has been shown that elevated expression of RRM1 and CDA genes is correlated with low survival and gemcitabine resistance in patients with the pancreatic cancer. Even some of the studies have considered a predictive value for RRM1 and CDA level.
MiRNAs are small non-coding RNAs with an important role in gene regulation. Most miRNAs exert their effect by binding to 3′UTR of their target mRNAs and inhibiting their translation. Aberrant expression of miRNAs has been found in many human diseases, especially cancer. Depending on their targets, miRNAs are categorized in two classes: onco-miRs and tumor-suppressor-miRs. Like normal tissue, some cancers exhibit unique expression signature of specific miRNAs. MiRNA based therapy has a great potential in cancer treatment via simultaneous targeting of several mRNAs involved in unique pathways. Also, some miRNAs are able to act as markers for distinguishing between benign or malignant tumors or even determining tumor grade.
The present study uncovers the new role of miR-608 in gemcitabine resistant clones derived from pancreatic cancer cell lines. Previous studies showed the association between miR-608 polymorphism and recurrence of nasopharyngeal carcinoma (7, 8), but its role and targets in pancreatic cancer remain unknown.
First, gemcitabine resistant clones from MiaPaCa-2 and AsPC-1 cell lines were established with gradually increasing gemcitabine concentration above the LC50 dose. Continued exposure to gemcitabine resulted in the appearance of resistant cells as the LC50 dose for each cell was increased (Figure ).
Overexpression of CDA and RRM1 is involved in the appearance of gemcitabine resistant cells. It was suggested that overexpression of RRM1 could result in increased deoxynucleoside triphosphate (dNTP) concentration, which can compete with incorporation of triphosphorylated gemcitabine into DNA (6). In fact, MiaPaCa2 resistant clones with higher RRM1 mRNA uptake less gemcitabine level (6). QRT-PCR was performed to find out the expression level of RRM1 and CDA genes in resistant cells. Consistent with previous data, the expression level of both genes was higher compared to sensitive cells (Figure ).
Next, we searched for miRNAs that target RRM1 and CDA. Our favorite miRNA candidate was a miRNA that could target both genes with a good score. Luckily, bioinformatic analysis showed that miR-608 has complementary sequences in 3′UTR of both genes. If miR-608 targets RRM1 and CDA, its expression level should be correlated with its target in both sensitive and resistant cells. Fortunately, miR-608 level correlated with RRM1 and CDA level, so that its expression declined dramatically in resistant cells (Figure ). To understand the correlation of miR-608 level with RMM1 and CDA expression, miR-608 was transfected into pancreatic cell lines and the expression level of both genes was determined. The expression level of miR-608 was reversely correlated with the expression of RRM1 and CDA genes (Figure ). These results suggested that RRM1 and CDA are putative targets of miR-608 in pancreatic cancer cell lines.
Moreover, luciferase assay was done to validate whether miR-608 is directly responsible for downregulation of RRM1 and CDA. 3′UTR of both genes was cloned in a luciferase vector and co-transfected with miR-608. Significant inhibition of luciferase expression confirmed that RRM1 and CDA are imminent targets of miR-608 in pancreatic cancer cell line.
In the end, if overexpression of RRM1 and CDA plays a role in the appearance of gemcitabine cells, could their downregulation increase sensitivity to gemcitabine? To answer this question, miR-608 was overexpressed in the cells and treated with gemcitabine. Cell viability assay showed that elevated miR-608 level considerably increased sensitivity to gemcitabine compared to cells with a normal level of miR-608 (Figure). This data suggested that miR-608 can revert back sensitivity to gemcitabine resistant cells through targeting RRM1 and CDA genes in pancreatic cancer cells.
In summary, we provide a new understanding of the role of miR-608 in pancreatic cancer development. This miRNA negatively regulates the genes involved in DNA synthesis by providing nucleotides. Our result is the first report revealing direct repression of RRM1 and CDA expression by miR-608 in pancreatic cell lines. Furthermore, we show that downregulation of RRM1 and CDA could reverse gemcitabine resistant phenotype and increase sensitivity to gemcitabine. To date, only few miRNAs have been connected with drug resistance phenotype in pancreatic cancer, including miR-15a, miR-21, miR-34, miR-200b and miR-200c, miR-214 and miR-221. Unfortunately, only few miRNAs have been studied for their targets and role in drug resistance in pancreatic cancer.
Tumor-suppressor-miRs have been indicated as ideal therapeutic tools in battle against cancer. On the other hand, several hurdles, including nucleases degradation, weak intracellular delivery, quick plasma removal, renal toxicities and so forth impede the development of miR-based drugs. In the last decade, multiple technologies have been developed to establish promising clinical delivery agents. In this regard, it seems that much work remains to be done and new miRNAs must be identified in this process. We suggest that the overexpression of miR-608 along with gemcitabine could augment the effect of chemotherapy in pancreatic cancer patients. To achieve this goal, more analysis and assays have to be done; for instance, the expression level of miR-608 and its targets should be measured in large clinical samples and the effect of miR-608 in drug resistance should be estimated in mouse models.
References
1. Long, J., et al., Overcoming drug resistance in pancreatic cancer. Expert opinion on therapeutic targets, 2011. 15(7): p. 817-828.
2. Valsecchi, M.E., et al., Is there a role for the quantification of RRM1 and ERCC1 expression in pancreatic ductal adenocarcinoma? BMC cancer, 2012. 12(1): p. 1.
3. Fujita, H., et al., Gene expression levels as predictive markers of outcome in pancreatic cancer after gemcitabine-based adjuvant chemotherapy. Neoplasia, 2010. 12(10): p. 807-IN8.
4. Hagmann, W., R. Jesnowski, and J.M. Löhr, Interdependence of gemcitabine treatment, transporter expression, and resistance in human pancreatic carcinoma cells. Neoplasia, 2010. 12(9): p. 740-747.
5. Feig, C., et al., The pancreas cancer microenvironment. Clinical Cancer Research, 2012. 18(16): p. 4266-4276.
6. Kim, M.P. and G.E. Gallick, Gemcitabine resistance in pancreatic cancer: picking the key players. Clinical Cancer Research, 2008. 14(5): p. 1284-1285.
7. Shi, X., et al., Acquired resistance of pancreatic cancer cells towards 5-Fluorouracil and gemcitabine is associated with altered expression of apoptosis-regulating genes. Oncology, 2002. 62(4): p. 354-362.
8. Bhutia, Y.D., et al., CNT1 expression influences proliferation and chemosensitivity in drug-resistant pancreatic cancer cells. Cancer research, 2011. 71(5): p. 1825-1835.
9. Ueno, H., K. Kiyosawa, and N. Kaniwa, Pharmacogenomics of gemcitabine: can genetic studies lead to tailor-made therapy? British journal of cancer, 2007. 97(2): p. 145-151.
10. Nakahira, S., et al., Involvement of ribonucleotide reductase M1 subunit overexpression in gemcitabine resistance of human pancreatic cancer. International journal of cancer, 2007. 120(6): p. 1355-1363.
11. Souglakos, J., et al., Ribonucleotide reductase subunits M1 and M2 mRNA expression levels and clinical outcome of lung adenocarcinoma patients treated with docetaxel/gemcitabine. British journal of cancer, 2008. 98(10): p. 1710-1715.
12. Nakano, Y., et al., Gemcitabine chemoresistance and molecular markers associated with gemcitabine transport and metabolism in human pancreatic cancer cells. British journal of cancer, 2007. 96(3): p. 457-463.
13. Jordheim, L.P. and C. Dumontet, Do hENT1 and RRM1 predict the clinical benefit of gemcitabine in pancreatic cancer? Biomarkers in medicine, 2013. 7(4): p. 663-671.
14. Jordheim, L.P., et al., The ribonucleotide reductase large subunit (RRM1) as a predictive factor in patients with cancer. The lancet oncology, 2011. 12(7): p. 693-702.
15. Elnaggar, M., E. Giovannetti, and G. J Peters, Molecular targets of gemcitabine action: rationale for development of novel drugs and drug combinations. Current pharmaceutical design, 2012. 18(19): p. 2811-2829.
16. Sugiyama, E., et al., Pharmacokinetics of gemcitabine in Japanese cancer patients: the impact of a cytidine deaminase polymorphism. Journal of clinical oncology, 2006. 25(1): p. 32-42.
17. Funamizu, N., et al., Is the resistance of gemcitabine for pancreatic cancer settled only by overexpression of deoxycytidine kinase? Oncology reports, 2010. 23(2): p. 471-475.
18. Rukov, J.L. and N. Shomron, MicroRNA pharmacogenomics: post-transcriptional regulation of drug response. Trends in molecular medicine, 2011. 17(8): p. 412-423.
19. Naderi, E., et al., Network of microRNAs-mRNAs interactions in pancreatic cancer. BioMed research international, 2014. 2014.
20. Rukov, J.L., et al., Pharmaco-miR: linking microRNAs and drug effects. Briefings in bioinformatics, 2013: p. bbs082.
21. Hashimoto, Y., Y. Akiyama, and Y. Yuasa, Multiple-to-multiple relationships between microRNAs and target genes in gastric cancer. PloS one, 2013. 8(5): p. e62589.
22. Zhang, X.J., et al., Dysregulation of miR-15a and miR-214 in human pancreatic cancer. J Hematol Oncol, 2010. 3(1): p. 46.
23. Hwang, J.-H., et al., Identification of microRNA-21 as a biomarker for chemoresistance and clinical outcome following adjuvant therapy in resectable pancreatic cancer. PLoS One, 2010. 5(5): p. e10630.
24. Ji, Q., et al., MicroRNA miR-34 inhibits human pancreatic cancer tumor-initiating cells. PLoS One, 2009. 4(8): p. e6816.
25. Li, Y., et al., Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Cancer research, 2009. 69(16): p. 6704-6712.
26. Park, J.-K., et al., Antisense inhibition of microRNA-21 or-221 arrests cell cycle, induces apoptosis, and sensitizes the effects of gemcitabine in pancreatic adenocarcinoma. Pancreas, 2009. 38(7): p. e190-e199.