Home > Sample essays > Bifunctional activity of the ent-kaurene oxidase from Montanoa tomentosa and its N-terminal modified version for production of isokaurenoic acid and kaurenoic acid in engineered yeasts

Essay: Bifunctional activity of the ent-kaurene oxidase from Montanoa tomentosa and its N-terminal modified version for production of isokaurenoic acid and kaurenoic acid in engineered yeasts

Essay details and download:

  • Subject area(s): Sample essays
  • Reading time: 9 minutes
  • Price: Free download
  • Published: 1 April 2019*
  • Last Modified: 23 July 2024
  • File format: Text
  • Words: 1,391 (approx)
  • Number of pages: 6 (approx)

Text preview of this essay:

This page of the essay has 1,391 words.



We report the bifunctional activity of the native ent-kaurene oxidase from Montanoa tomentosa (MtKO) and its N-terminal modified version (LMtKO) for producing both isokaurenoic acid and kaurenoic acid in Saccharomyces cerevisiae. The Km app of MtKO showed more affinity for ent-kaurene (80.5 µM) than for isokaurene (96.4 µM). Interestingly, LMtKO exhibited an increase of the affinity for isokaurene (79.6 µM) but simultaneously showed an enhancement in the Vmax for both substrates (32.6-38.9 μmol-1mg-1h-1). Biotransformation assays using isokaurene and yeasts containing LMtKO, resulted in 70% more production of isokaurenoic acid, when compared with the yields from yeasts expressing MtKO. Likewise, biotransformation assays using geranylgeraniol and double transformed cells of S. cerervisiae containing an optimized version of the ent-kaurene synthase  from Phaeosphaeria sp. L487 and the LMtKO, produced ~25% more kaurenoic acid than the yeasts containing the same ent-kaurene synthase and MtKO.  The isokaurenoic acid synthesized by transgenic yeasts was tested for its anti-acetylcholinesterase and antimicrobial properties. Isokaurenoic acid generated a non-competitive inhibition on acetylcholinesterase, decreasing Vmax from 0.0249 to 0.104 Mm min−1 whereas the Km (0.704 mM) was not significantly changed. The same diterpene showed a potent antifungal activity against Fusarium oxysporum Aspergillus niger and Phytophtora infestans with a minimum inhibitory concentration of 15.3, 18.3 and 19.2 µg mL-1, respectively.

Keywords: isokaurenoic acid, kaurenoic acid, engineered yeasts, anti-acetylcholinesterase, antimicrobial.

Abbreviations

MtKO ent-kauerene oxidase from Montanoa tomentosa

LMtKO N-terminal modified version of the ent-kauerene oxidase from Montanoa tomentosa

KS ent-kaurene synthase

RP-HPLC Reversed Phase-High Performance Liquid Chromatography

AChE Acetylcholinesterase

Km app Apparent Michaelis–Menten constant

Vmax Maximum velocity

Introduction

Kaurane type diterpenes show relevant activity in pharmacology and in biological control (Garcia et al. 2007). The multifunctional enzymes involved in their biosynthesis represent a valuable source for biotechnological aims. Therefore, the heterologous expression of those enzymes in microbial systems is quite attractive to create sustainable platforms for scaling their production (Zhuang et al. 2013). Kaurenoic acid is the most relevant natural tetracyclic diterpene tested for several biological activities. As a result of the investigations on kaurenoic acid, it has been revealed its hypoglycemic, analgesic, selective cytotoxic and antimicrobial properties (Ghisalberti et al. 1997).  The diterpene is also a substrate for the production of novel kaurane type diterpenes with specific pharmacological potentials (Garcia et al. 2007).  Kaurenoic acid is biosynthesized by ent-kaurene synthases (KS) [EC 4.2.3.19], enzymes that conventionally catalyze the conversion of geranylgeranyl diphosphate into ent-kaurene (Kawaide et al. 1997).  Complete oxidation of ent-kaurene in C19 is carried out by ent-kaurene oxidases (KO) [EC 1.14.13.78], which have shown multifunctional activity in other methylated diterpenes (Morrone et al. 2010). On the other hand the complete biosynthesis and biological activities of other related kaurane diterpenes such as isokaurenoic acid (16-Methylkaur-15-en-19-oic acid), remain unknown. A previous report on the biochemical properties of the KO from Montanoa tomentosa (MtKO) reveals that the enzyme possesses a high specific activity and a high Km app value, suggesting its possible biochemical promiscuity (Villa-Ruano et al. 2015a). In this work we present the bifunctional activity of the MtKO from M. tomentosa and the effect of a N-terminal modification in the native enzyme. We also reported the biotransformation of geranylgeraniol into kaurenoic acid by double transformed cells of Saccharomyces cerevisiae, which contained a synthetic optimized version of the fungal KS from Phaeosphaeria sp. L487 and a modified version of the MtKO from M. tomentosa.

Materials and methods

Cloning and heterologous expression of MtKO and LMtKO

The cDNA of the native MtKO was amplified and cloned in the pCR®8/GW/TOPO vector (Invitrogen TM) in accordance with Villa-Ruano et al. (2015a). A modification in the 5´end (N-terminal) of the cDNA was performed by the amplification of the native sequence with the oligonucleotides ATGGCGTTGTTGCTGGCAGTCCC and TCAATTTCTGGGCTTTATTAAGGCACG using the enzyme Taq DNA polymerase from (Invitrogen TM). The PCR conditions were done as described by the same authors.  The PCR product was cloned in the same vector for immediate replication in the strain TOP10F´of Escherichia coli. The plasmid was extracted using the QIAprep Spin Miniprep Kit, Quiagen® and posteriorly analyzed in an ABI PRISM 3700 instrument sequencer (ABI, Foster City, CA). Both the native cDNA’s of MtKO and its modified version (LMtKO), were cloned by LR recombination into the PYESDEST52 vector (Invitrogen TM), using the LR Clonase enzyme (Invitrogen TM). The constructions were replicated and analyzed as previously mentioned and they were inserted in the strain W303 (genotype: MATa/MATα {leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11, 15} [phi+]) of Saccharomyces cerevisiae in accordance with Villa-Ruano et al. (2015a). The selection of transformed yeasts and the induction of the heterologous proteins under GAL1 promoter were carried out in accordance with the same authors.  

Bifunctional characterization of MtKO and  LMtKO

100 mL of transformed yeasts were grown in liquid SC minimal medium without uracil until an OD600=0.9. The yeasts were pelleted (2 min at 14,000 rpm,) and the medium was replaced by SC containing galactose for 8 h with slight shaking (100 rpm). Microsomal fractions were obtained in accordance with Villa-Ruano et al. (2015a). Enzymatic assays were performed with 0.5 mg microsomal protein and ent-kaurene or ent-isokaurene in the range a range of 50-100 µM for both methylated diterpenes. The composition of enzymatic assays and the calculation of apparent kinetic parameters and IC50 were all carried out according to the same authors.  The recuperation of the enzymatic products from the mixtures was carried out with 20 mL of hexane: ethyl acetate (85:15 v/v) in triplicate. The organic fractions were concentrated to 500 µL and then prepurified in TLC silica gel plates impregnated with 20% silver nitrate (60G 10X10 cm) using the same solvent system as mobile phase and finally, the products were scratched out in accordance with the retention factor of authentic standards. The compounds were recovered from the silica three times with the same solvent system (20 mL). The fractions were dried under N2 stream and resuspended in methanol for further RP-HPLC analyses.

Cloning of an optimized version of the KS from Phaeosphaeria sp. L487

The open reading frame of the KS from the fungus Phaeosphaeria sp. L487 was optimized for its expression in yeast, requesting the commercial services of GenScript USA Inc., the Biology CRO (Supplementary Sequence 1). The optimized cDNA was cloned in the vector pUC57 and amplified by PCR using the oligonucleotides AAGCTTATGTTCGCAAAGTTCGATATGTTG and CTTAAGTCAAGTACCGACGTGCTTCAAGGA containing the HindIII and EcoRI restriction sites. The PCR program consisted of 94 °C for 5 min initial denaturation, followed by 35 cycles of 94 °C for 35 s, 55 °C for 40 s, and 72 °C for 1 min 40 sec.  The amplicon was subsequently cloned in the vector PYES6CT (Invitrogen TM ) using the respective restriction enzymes and T4DNA ligase from Invitrogen TM. The construction was replicated in the strain TOP10 F’ from E. coli strain, extracted as previously described and posteriorly,  analyzed in a ABI PRISM 3700 instrument sequencer (ABI, Foster City, CA). The construction was inserted in the transformed cells of S. cerevisiae W303 containing the MtKO and LMtKO by the lithium acetate protocol (Rose et al. 1999). The transformed cells were selected by blasticidin resistance (100 µg mL-1) and the induction of the heterologous protein was achieved in accordance with the PYES6CT manufacturer’s recommended conditions.

Feeding experiments with isokaurene, ent-kaurene and geranylgeraniol

Feeding experiments were carried out using 100 mL of single transformed yeast cells containing the native MtKO or LMtKO and the doubled transformed cells containing additionally the optimized version of the KS from Phaeosphaeria sp. L487. The yeasts were grown (OD600=0.9) and induced for protein expression as described by the manufacturer in order to synthesize the recombinant enzymes by the activation of GAL1 promoter. Ent-kaurene, isokaurene and geranylgeraniol were dissolved in ethanol and were immediately added in the range of 50- 1000 µg to the transformed cells. The reactions were incubated with vigorous shaking for 8 h at 30 °C. The enzymatic products were recovered from the culture medium with 20 mL of hexane: ethyl acetate (85:15 v/v) in triplicate. The enzymatic products were prepurified by TLC silica gel plates impregnated with 20% silver nitrate (60G 10X10 cm) and the products were scratched out in accordance to the retention factor of authentic standards. The compounds were recovered three times from the silica gel using 20 mL of the same solvent system. The solvent was dried under N2 stream and then resuspended in methanol for further RP-HPLC analyses. The yields of the biotransformation products were calculated in the order of g L-1. All the assays were made in quintuplicate and the results were analyzed by ANOVA coupled to a Tukey Test (p<0.01).

Obtainment of the diterpene standards and analyses of the enzymatic products

Ent-kaurene and isokaurene (16-Methylkaur-15-en-19-oic acid) were a gift of Dr. Lew Mander and Tony Herlt from the Australian National University. These diterpenes were assessed and/or used as standards to produce it from free endosperm lysates of Cucurbita pepo using mevalonate (Sigma-Aldrich Co., St Louis Missouri) as a precursor.  Geranylgeraniol was purchased from Sigma-Aldrich Co., St Louis Missouri. Ent-kaurenoic acid was isolated from the leaves of Montanoa tomentosa and purified by HPLC in accordance with Villa-Ruano et al. (2009). Isokaurenoic acid was purified from Annona glabra with the TLC method described by Batista et al. (2010). The enzymatic products were analyzed by RP-HPLC in accordance with Pérez et al. (2014) in a Hewlett Packard 1050 system coupled to a HP G1306A diode array detector.

Anti-acetylcholinesterase (AChE) activity of enzymatic products

The isokaurenoic acid and kaurenoic acid produced by transgenic yeasts were assessed for its possible AChE inhibition in accordance with Villa-Ruano et al. (2015b). IC50 was obtained in accordance with the same authors. Physostigmine salicylate (Sigma–Aldrich Co. St Louis Missouri) was used as a reference standard. All the experiments were performed in quintuplicate.

Antimicrobial activity of isokaurenoic acid

The growth inhibitory activity of the isokaurenoic acid produced by transgenic yeasts was tested against Erwinia carotovora, Clavibacter michiganensis, Fusarium oxysporum, Phytophthora infestans, Rhizopus stolonifer, Aspergillus niger. All the assays were performed in quintuplicate in accordance with the protocols described by Villa-Ruano et al. (2015b).

Results and discussion

MtKO produces both isokaurenoic acid and  kaurenoic acid

Enzymatic assays with microsomal fractions containing the native MtKO (Supplementary Sequence 2) in the presence of isokaurene and cofactors were able to produce isokaurenoic acid as the main compound (Fig. 1). Other unidentified compounds were also detected from those assays. Interestingly, the same activity was maintained in the microsomal fractions expressing LMtKO (See Supplementary Sequence 3). Isokaurenoic acid and other compounds were not observed in enzymatic assays containing microsomes from non-transformed W303 yeast cells (Fig. 1). On the other hand, LMtKO was able to convert ent-kaurene into kaurenoic acid (Fig. 2).  Kinetic studies of LMtKO and MtKO revealed changes in the Km app and Vmax for ent-kaurene and isokaurene (Table 1).  According to the Km app, native MtKO showed more affinity for ent-kaurene than for isokaurene. Surprisingly, LMtKO exhibited an increase of the affinity for isokaurene but simultaneously, it was also observed an enhancement in the Vmax for both substrates. A previous report describes the biochemical characterization of the MtKO enzyme from Montanoa tomentosa in a heterologous system and in the plant itself (Villa-Ruano et al. 2015a). Nevertheless, this work describes the bifunctional properties of the enzyme and also the activity of its modified form denominated as LMtKO. The presence of isokaurenoic acid in some species of the Montanoa genus could probably be explained by the promiscuous activity of this enzyme (Quijano et al. 1987). The multifunctional activity of KO enzymes from plant models has already been demonstrated (Morrone et al. 2010).  This is the case of the KO’s from Arabidopsis thaliana (AtKO) and Oryza sativa (OsKO2), which are able to oxidize a wide range of methylated diterpenes such as ent-trachylobane, ent-cassadiene, ent-beyerene between other 20 substrates (Mafu et al. 2016). KO´s from non-model plants that biosynthesize and accumulate high amounts of diterpenes could reveal interesting biochemical properties for biotechnological aims. Further studies are required to determine the ability of MtKO and its modified forms to metabolize other methylated diterpenes.

Biotransformation of isokaurene and geranylgeraniol by transformed cells of Saccharomyces cerevisiae

According to our results, feeding experiments with isokaurene resulted in the production of isokaurenoic acid as the main product of the biotransformation from yeasts containing the MtKO and LMtKO sequences (Fig. 3B).  On the other hand, geranylgeraniol was also converted into kaurenoic acid by the double transformed cells of S. cerevisiae which contained the same sequences and the optimized KS from Phaeosphaeria sp. L487 (Fig. 3C).  The yields of biotransformation products are shown in the Fig. 4. Double transformed cells containing the optimized version of the KS from Phaeosphaeria sp. L487 and LMtKO produced ~25% more kaurenoic acid than the yeast containing the same KS and the native MtKO (Fig. 4A).  Similar results were found for the biotransformation of ent-kaurene where LMtKO generated 28% more kaurenoic acid than MtKO (Fig. 4B). Interestingly, LMtKO was able to produce 70% more isokaurenoic acid than MtKO using isokaurene as alternative substrate (Fig. 4B). Biotransformation process in microorganisms represents a cheap alternative to produce bioactive natural products. Previous assays with transgenic yeasts containing the ent-kaurene oxidases from Arabidopsis thaliana, Stevia rebaudiana and Montanoa tomentosa showed that S. cerevisiae have the ability to transport the diterpene precursors inside of the microorganism and also to excrete the enzymatic products to the culture medium (Helliwell et al. 1999; Humphrey et al. 2006; Zhuang et al. 2013; Villa-Ruano et al. 2015a).  This characteristic should be essential for further production of kaurenoids in bioreactors. The yields of the compounds of interest were higher in transgenic yeasts containing the modified ent-kaurene oxidase from Montanoa tomentosa (LMtKO). This fact corroborates that LMtKO is suitable for the obtainment of both isokaurenoic acid and kaurenoic acid.

 Anti-AChE activity

Kaurenoic and isokaurenoic acids produced by transgenic yeasts, showed potent inhibitory activity against AChE. The IC50 values were 12.7 and 8.4 µg mL-1 for kaurenoic acid and isokaurenoic acid, respectively.  Under controlled conditions AChE showed a Km= 0.704 mM and Vmax= 0.0249 Mm min−1. The activity of AChE was only affected by both kaurenoids in the Vmax. Kaurenoic acid reduced this parameter from 0.0249 to 0.123 Mm min−1 whereas isokaurenoic acid decreased Vmax from 0.0249 to 0.104 Mm min−1. These results strongly suggest that these kaurenoids exerts a non-competitive inhibition on AChE. Previous reports on the anti-AChE properties of the diterpenes from Aralia cordata, revealed that kaurenoic acid had a similar IC50 value to the reported in our results (Jung et al. 2009). However, this is the first work reporting the inhibitory activity of isokaurenoic acid on this enzyme, which was more effective than kaurenoic acid.

Antimicrobial activity

Isokaurenoic acid showed potent inhibitory activity against all the assayed phytopathogenic bacteria and fungi (Table 2). Remarkably, F. oxysporum, A. niger and P. infestans were the most sensitive to the diterpene. Contrary to kaurenoic acid, the bioactivity of isokaurenoic acid has been poorly tested so far. This fact is probably due to its unusual presence in plant sources. Only a previous investigation reported the antifeedant and partial antifungal properties of this compound isolated from Wedelia biflora (Miles et al. 1990). However, in this work we confirm the antibacterial and antifungal activity of the same diterpene.

This study shows the bifunctional activity of the MtKO from Montanoa tomentosa for the production of isokaurenoic and kaurenoic acids. The modified version of this enzyme (LMtKO) showed an enhancement in the specificity for kaurene and isokaurene and in the Vmax of the protein.  This property confers a higher biotransformation yields for transgenic yeasts containing the coding sequence of the LMtKO. Further studies are required to evaluate the metabolism of other methylated diterpenes in order to determine the promiscuity of this enzyme. Some biological activities were tested for isokaurenoic acid, revealing novel antibacterial, antifungal and anti-acetylcholinesterase properties.

Acknowledgments

The authors of this work thank CONACyT-México for the grant CB-2010-151144Z. Iván D-O and María Blanca E. L-V thank CONACyT-México for the scholar fellowships 19445 and 276222, respectively. All the Authors specially thank Dr. Plinio Guzman Villate and M. en C. Laura Aguilar Henonin from CINVESTAV-Irapuato, for the donation of the strain W303 of Saccharomyces cerevisiae

About this essay:

If you use part of this page in your own work, you need to provide a citation, as follows:

Essay Sauce, Bifunctional activity of the ent-kaurene oxidase from Montanoa tomentosa and its N-terminal modified version for production of isokaurenoic acid and kaurenoic acid in engineered yeasts. Available from:<https://www.essaysauce.com/sample-essays/2016-7-27-1469627388/> [Accessed 30-05-26].

These Sample essays have been submitted to us by students in order to help you with your studies.

* This essay may have been previously published on EssaySauce.com and/or Essay.uk.com at an earlier date than indicated.