Home > Sample essays > Identification and Molecular Systematics of Epiphytic Algal Community in Laminariales Plants around San Juan Islands

Essay: Identification and Molecular Systematics of Epiphytic Algal Community in Laminariales Plants around San Juan Islands

Essay details and download:

  • Subject area(s): Sample essays
  • Reading time: 9 minutes
  • Price: Free download
  • Published: 1 April 2019*
  • Last Modified: 23 July 2024
  • File format: Text
  • Words: 2,337 (approx)
  • Number of pages: 10 (approx)

Text preview of this essay:

This page of the essay has 2,337 words.



ay in

Identification and molecular systematics of the epiphytic algal community in Costaria costata (Costariaceae, Laminariales) and other Laminariales plants around Friday Harbor Labs, San Juan Islands, Washington, USA.

Ronald P. Kittle III1

Marine Botany: Diversity and Ecology (FHL 446: Summer A 2018)

1 University of Louisiana at Lafayette, Lafayette, Louisiana, 70504-3602, USA

Contact Information:

Ronald Paul Kittle III

Department of Biology

University of Louisiana at Lafayette

410 E. St. Mary Blvd.

Lafayette, LA 70503

RonaldKittleULL@gmail.com

Keywords: Costaria costata, kelp, epiphyte, universal plastid amplicon (UPA), San Juan Islands.

Table of Contents

Abstract

   THIS IS THE ABSTRACT. I WILL WORK ON THIS LATER. 500 words or less. Yellow highlighted items are references, whereas green is missing information that I need to ask TM and W. FH2O.

Introduction

Kelp Bed Ecology

Kelp forests are multilayered assemblages of seaweeds and their associated fauna, where kelp canopies are found in virtually all temperate and subpolar rock habitats ranging from low intertidal zones to around 40 m depth. The canopies may consist of: plants having short stipes and forming a layer just above the substratum (such as Hedophyllum or Agarum); plants having larger robust stipes and can project ~1 meter into the water column (such as Pterygophora or Laminaria) (Bekkby et al. 2014). Kelp forests are ecologically important due habitat refuges for marine organisms (Haldorson and Richards 1987, Hayden-Spear 2006) a food source for nearshore grazers (Shaffer 2003) and can help with larval recruitment (Duggins et al. 1989, Duggins et al. 1990). Kelps can also reduce wave energy, which influences sediment grain size and turbidity which impacts the beach dynamics. Invasive species (like Sargassum muticum) pose a threat to kelp habitat, where Saccharina grew more than 2x as fast where S. muticum is absent (Britton-Simmons 2004).

The life history of kelp species (Laminariales) includes the alternation of generations where the large plant (sporophyte) produces planktonic spores that settle on the bottom. The spores will germinate into male and female gametophytes, which environmental cues trigger the production of eggs or sperm that will grow into the kelp plant (Mumford 2007) (Figure X).

Figure 1. Representation of the life history in Laminariales (Hawes et al. 2004).

Epiphyte Ecology

The effects of epiphytes on their host plants can be beneficial (Orth and Montfrans 1984), such as minimize the effects of desiccation (Penhale and Smith 1977). More often than not, these associations are harmful (Jacobs 1988).  Epiphytes are known to decrease productivity (Sand-Jensen 1977), indirectly influence macrophyte abundance due to diminishing the light energy and nutrients that reach the host plant (Orth and Montfrans 1984). Seagrasses and kelps are known to shed senescent or costly parts under adverse conditions as a potential survival strategy for long-lived plants (Chapman and Craigie 1977, Littler and Littler 1980, Sand-Jensen and Borum 1991). There are over 280 species of epiphytic marine algae to grow upon or in the thallus of Laminariales plants in which 22 species belong to Chlorophyta, 116 species to Phaeophyceae, and 144 species to Rhodophyta (Tokida 1960).  Epiphyte density may be dependent on a wave exposure gradient, such as limitations due to adequate substrate in exposed sites or conversely, the quantity of available sporelings maybe the factor in density of epiphytes in protected sites (Levin and Mathieson 1991).

   

The purpose of this paper is to characterize the epiphytic community in Laminariales plants and investigate any phylogenetic relationships among epiphytes and the hosts using microscopy and molecular sequencing.

Methods

Study/Collection Site

Specimens were collected off of the Friday Harbor Labs dock from 11 June to 18 June 2018 (48.5458, -123.01114) and also collected with an hourglass-design box dredge using minimum tow periods, usually 5 minutes or less (Joyce & Williams 1969) three times on 19 June 2018, deployed by the R/V Centennial, stationed at Friday Harbor Labs in the vicinity of Canoe Island (48.4500, -122.96600) (Fig 2). {NUMBER} collected specimens were desiccated in silica gel, preserved in 25% Karo solution for permanent slides, and pressed on acid-free herbarium paper as vouchers. Herbarium vouchers were deposited in the University of Washington Herbarium (WTU) and the University of Louisiana at Lafayette Herbarium (LAF).

Figure 2. Map of San Juan Archipelago with collection sites in black dots using qGIS v. 3.0.2.

Identification – Light and Scanning Electron Microscopy (WOULD LOVE TO…if time)

Thallus organization and anatomy were investigated with light microscopy (LM) (Olympus BH-2) and scanning electron microscopy (SEM) according to Richards et al. (2016). Portions of the thallus from silica gel-dried specimens were removed using a razor blade, and forceps. Crustose specimens were sectioned by performing vertical fractures (cutting from thallus surface to substratum) whereas protuberances were sectioned longitudinally (through the middle of the protuberance from tip to base) and transversely (through the lateral sides of protuberance). Specimens were sectioned manually using a new single edge razor blade for each fracture and were mounted using liquid graphite and coated with 15 nm of gold. To ensure even distribution of the gold over the three-dimensional features in the sections, coating were performed in two applications. First, 8 nm of gold were applied with the stub lying flat on the stage of the coating chamber. After the first application, the specimen were tilted using a coin placed underneath the stub and a second application of 7 nm of gold was performed. Specimens were viewed using a Hitachi S-3000N SEM at a voltage of 15 kV, housed at Friday Harbor Labs, following the manufacturer’s instructions. Cell dimensions were measured from SEM micrographs following the protocols of Irvine and Chamberlain (1994) and Adey et al. (2005).

Identification – DNA Extraction – PCR/PCR Clean Up

DNA was extracted from thalli using the MyTaq™ Extract-PCR Kit (Bioline Cat No: BIO-21126). Polymerase Chain Reaction (PCR) up was done using the One Step PCR Inhibitor Removal Kit (Zymo, Cat No: D6030) with either full strength, 1:10, 1:100, or 1:500 extraction dilutions according to the manufacturer’s instructions. The 23S plastid rRNA universal plastid amplicon (UPA, [ # ] ~bp, Supplementary Table 1.) was used because it has been used successfully in amplifying and sequencing diverse algal species, including red, brown, and green algae, diatoms, euglenoids, xanthophytes and cyanobacteria (Sherwood & Presting 2007) and it may be useful for distinguishing very closely related taxa of red algae, but that it is relatively conserved within a species level group. The cycle used was as follows: initial denaturation at 95°C for 2:45 minutes, followed by 35 cycles of 95°C for 15 seconds, 45°C for 15 seconds, 72°C for 1min, with a final extension of 72°C for 4 min. Reaction volume for all PCR reactions was 12.5 μL, consisting of 1.0 μL genomic DNA, 6.25 μL MyTaqMix, 10 μM of each primer (0.5 μL of each), and 4.25 μL dH2O according to the manufacturer’s instructions.

The resulting amplicons were viewed under ultraviolet light on 1% agarose gel (80 V, 60 min) stained with { }, and were measured by comparison with 1Kb plus DNA Ladder (Invitrogen, Carlsbad, EUA) as a molecular marker. The PCR products were purified using Illustra ExoProStar 1-Step (GE Healthcare, Buckinghamshire, UK), then sequenced in both directions (Genewiz, South Plainfield, NJ, USA.

 [ ] sequences of the UPA gene in the were downloaded from the NCBI database to infer phylogenetic relationships with the samples extracted. Alignment of sequences were done in MUSCLE v3.8.31 with max iterations, and “-” characters were converted to “N”. Sequences were compared for similarity to the sequences available in GenBank (http://www.ncbi.nlm.nih.gov/BLAST).

 PartitionFinder v2.1.1 was used to determine the model of evolution partitioned per codon position for the datasets. RAxML trees were made using RAxML-HPC2 XSEDE on CIPRES with 10,000 bootstraps for the UPA gene.

RAxML/Bayesian Analyses

Barcode trees and phylogenies were reconstructed from data sets using RAxML and Bayesian analysis, among others. Species concepts were delimited using a suite of approaches, including GMYC (Fujisawa & Barraclough 2013) and ABGD (Puillandre et al. 2012). For ABGD, branch lengths were extracted from the RAxML tree with the function cophenetic.phylo of the package APE in R (Paradis et al. 2004) to produce a distance matrix as input.  For the datasets, the resulting distance matrix were used to find species boundaries in a stand-alone version of Automatic to Barcode Gap Discovery (ABGD) (Puillandre et al. 2012). General Mixed Yule Coalescence (GMYC) model were implemented by the Splits Package in R (Fujisaway and Barraclough 2013) with a single threshold model to determine species boundaries.

Results

Microscopy Images

 

 

 

Figure X – X. Microscopic image of FHL18-51 (Identification TBD)] at 4x magnification (TM= 40X) [NEED TO ADD SCALE BAR]…. {AND OTHER MAJOR EPIPHYTES}.

Table of Identified Epiphytes

Table 1. Table of Identified Epiphytes on three kelp hosts.

Sample # Host/Epiphyte Order Family Genus species Habitat Collection Location GPS Coord. (Lat/Lon)

Host #1 Laminariales Agaraceae Costaria costata attached to tire Friday Harbor Labs Dock 48.5458, -123.01114

Epiphyte Ceramiales Ceramiaceae Antithamnion defectum on blade Friday Harbor Labs Dock 48.5458, -123.01114

Epiphyte Ceramiales Ceramiaceae Antithamnion sp. on stipe Friday Harbor Labs Dock 48.5458, -123.01114

FHL18-006 Epiphyte Ceramiales Rhodomelaceae Melanothamnus eastwoodiae on blade Friday Harbor Labs Dock 48.5458, -123.01114

Epiphyte Ceramiales Rhodomelaceae Polysiphonia sp. on stipe Friday Harbor Labs Dock 48.5458, -123.01114

FHL18-055 Epiphyte Erythrotrichiales Erythrotrichiaceae Smithora naiadum on blade Friday Harbor Labs Dock 48.5458, -123.01114

Epiphyte – – filamentous red 1 on stipe Friday Harbor Labs Dock 48.5458, -123.01114

FHL18-056 Epiphyte – – filamentous red 2 on holdfast Friday Harbor Labs Dock 48.5458, -123.01114

Epiphyte Bryopsidales Derbesiaceae Derbesia marina on blade Friday Harbor Labs Dock 48.5458, -123.01114

Epiphyte Ulvales Ulvaceae Ulva intestinalis on blade Friday Harbor Labs Dock 48.5458, -123.01114

Epiphyte Ulvales Ulvaceae Ulva sp. on holdfast Friday Harbor Labs Dock 48.5458, -123.01114

FHL18-029 Epiphyte Fucales Sargassaceae Sargassum muticum on  stipe Friday Harbor Labs Dock 48.5458, -123.01114

Epiphyte – – small brown blade on blade Friday Harbor Labs Dock 48.5458, -123.01114

Epiphyte Ulotrichales Ulotrichaceae Acrosiphonia sp. on stipe Friday Harbor Labs Dock 48.5458, -123.01114

Host #2 Laminariales Agaraceae Costaria costata on rock Cattle Point,  WA 48.4500, -122.96600

Epiphyte Ceramiales Ceramiaceae Antithamnion defectum on blade Cattle Point,  WA 48.4500, -122.96600

Epiphyte Ceramiales Rhodomelaceae Polysiphonia sp. on stipe/blade Cattle Point,  WA 48.4500, -122.96600

Epiphyte Erythrotrichiales Erythrotrichiaceae Smithora sp. on stipe/blade Cattle Point,  WA 48.4500, -122.96600

Epiphyte Ulvales Ulvaceae Ulva sp. on stipe Cattle Point,  WA 48.4500, -122.96600

Host #3 Laminariales Laminariaceae Saccharina latissima gravel bottom Canoe Island, WA 48.5592, -122.92954

Epiphyte Ceramiales Rhodomelaceae Polysiphonia sp. 1

on stipe Canoe Island, WA 48.5592, -122.92954

Epiphyte Ceramiales Rhodomelaceae Polysiphonia sp. 2

on stipe Canoe Island, WA 48.5592, -122.92954

To Be Continued… Epiphyte

Epiphyte

Phylogenetic Tree(s).

Here is where the phylogenetic trees will go.

Discussion

o Epiphytes Identified Compare LH Strategies/ Compare Adjacent Flora

o Discuss Phylogeny of Epiphytes

o Do Costaria costata harbor more diverse epiphytes vs other related species.

o Epiphytes vs location found on C. costata/other Laminariales.

o More Sequences Needed (Multi-Loci)

o ABGD/Species Delimitation Methods

References

1. Adey WH, Chamberlain YM, Irvine LM (2005) An SEM‐based analysis of the morphology, anatomy, and reproduction of Lithothamnion tophiforme (Esper) Unger (Corallinales, Rhodophyta), with a comparative study of associated North Atlantic Artic/Subartic Melobesioideae. Journal of Phycology, 41, 1010–1024.

2. Bekkby, T., Rinde, E., Gundersen, H., Norderhaug, K. M., Gitmark, J. K., & Christie, H. (2014). Length, strength and water flow: relative importance of wave and current exposure on morphology in kelp Laminaria hyperborea.

3. Britton-Simmons, K. H. (2004). Direct and indirect effects of the introduced alga Sargassum muticum on benthic, subtidal communities of Washington State, USA. Marine Ecology Progress Series, 277, 61-78.

4. Chapman, A. R. O., & Craigie, J. S. (1977). Seasonal growth in Laminaria longicruris: relations with dissolved inorganic nutrients and internal reserves of nitrogen. Marine Biology, 40(3), 197-205.

5. Duggins, D. O., Simenstad, C. A., & Estes, J. A. (1989). Magnification of secondary production by kelp detritus in coastal marine ecosystems. Science, 245(4914), 170-173.

6. Duggins, D. O., Eckman, J. E., & Sewell, A. T. (1990). Ecology of understory kelp environments. II. Effects of kelps on recruitment of benthic invertebrates. Journal of Experimental Marine Biology and Ecology, 143(1-2), 27-45.

7. Fujisawa, T., & Barraclough, T. G. (2013). Delimiting species using single-locus data and the Generalized Mixed Yule Coalescent approach: a revised method and evaluation on simulated data sets. Systematic biology, 62(5), 707-724.

8. Haldorson, L., Richards L (1987). Post-larval copper rockfish in the Strait of Georgia: Habitat use, feeding, and growth in the first year. In: Proc. INt. Rockfish Symp.,  Anchorage, Alaska Sea Grant Rept. No. 87-2

9. Hawes I, Nelson W, Mercer S (2004) Hang on to your haptera. Water Atmos. 12: 26–27.

10. Hayden-Spear, J. (2006). Nearshore habitat associations of young-of-year copper (Sebastes caurinus) and quillback (S. maliger) rockfish in the San Juan Channel, Washington(Doctoral dissertation, University of Washington).

11. Irvine, L. M., & Chamberlain, Y. M. C. (1994). Seaweeds of the British Isles, Vol 1, Part 2B. British Museum (Natural History), London.

12. Jacobs M.1988. The tropical rain forest. A first encounter. Springer-Verlag, Berlin. 295 pages.

13. JOYCE, E. A., AND J. WILLIAMS. 1969. Memoirs of the Hourglass Cruises: Rationale and pertinent data. Fla. Dep. Nat. Resour. Mar. Res. Lab., Vol. I, Pt. I

14. Levin, P. S., & Mathieson, A. C. (1991). Variation in a host-epiphyte relationship along a wave exposure gradient. Marine Ecology Progress Series, 271-278.

15. Littler, M. M., & Littler, D. S. (1980). The evolution of thallus form and survival strategies in benthic marine macroalgae: field and laboratory tests of a functional form model. The American Naturalist, 116(1), 25-44.

16. Mumford Jr, T. F. (2007). Kelp and eelgrass in Puget Sound(No. TR-2007-05). NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION SEATTLE WA PACIFIC MARINE ENVIRONMENTAL LABS.

17. Orth, R. J., Heck, K. L., & van Montfrans, J. (1984). Faunal communities in seagrass beds: a review of the influence of plant structure and prey characteristics on predator-prey relationships. Estuaries, 7(4), 339-350.

18. Paradis, E., Claude, J., & Strimmer, K. (2004). APE: analyses of phylogenetics and evolution in R language. Bioinformatics, 20(2), 289-290.

19. Penhale, P. A., & Smith, W. O. (1977). Excretion of dissolved organic carbon by eelgrass (Zostera marina) and its epiphytes. Limnology and Oceanography, 22(3), 400-407.

20. Puillandre, N., Lambert, A., Brouillet, S., & Achaz, G. (2012). ABGD, Automatic Barcode Gap Discovery for primary species delimitation. Molecular ecology, 21(8), 1864-1877.

21. Richards, J. L., Sauvage, T., Schmidt, W. E., Fredericq, S., Hughey, J. R., & Gabrielson, P. W. (2016). The coralline genera Sporolithon and Heydrichia (Sporolithales, Rhodophyta) clarified by sequencing type material of their generitypes and other species. Journal of phycology.

22. Sand-Jensen, K. A. J. (1977). Effect of epiphytes on eelgrass photosynthesis. Aquatic Botany, 3, 55-63.

23. Sand-Jensen, K., & Borum, J. (1991). Interactions among phytoplankton, periphyton, and macrophytes in temperate freshwaters and estuaries. Aquatic Botany, 41(1-3), 137-175.

24. Shaffer, S. (2004). Preferential use of nearshore kelp habitats by juvenile salmon and forage fish. In Proceedings of the 2003 Georgia Basin/Puget Sound Research Conference (Vol. 31, pp. 1-11).

25. TOKIDA, J. (1960). Marine algae epiphytic on Laminariales plants.  BULLETIN OF THE FACULTY OF FISHERIES HOKKAIDO UNIVERSITY 11(3), 73-105.

Supplementary Material

Table 2. Primer sequence of the 23S rRNA universal plastid amplicon.

Primer Sequence

p23SrV_f1 5' GGACAGAAAGACCCTATGAA 3'

p23SrV_r1 5' TCAGCCTGTTATCCCTAGAG 3'

 here…

About this essay:

If you use part of this page in your own work, you need to provide a citation, as follows:

Essay Sauce, Identification and Molecular Systematics of Epiphytic Algal Community in Laminariales Plants around San Juan Islands. Available from:<https://www.essaysauce.com/sample-essays/2018-6-21-1529563854-2/> [Accessed 10-04-26].

These Sample essays have been submitted to us by students in order to help you with your studies.

* This essay may have been previously published on EssaySauce.com and/or Essay.uk.com at an earlier date than indicated.