Home > Science essays > CRISPR gene editing of ADE2 gene (practical)

Essay: CRISPR gene editing of ADE2 gene (practical)

Essay details and download:

  • Subject area(s): Science essays
  • Reading time: 12 minutes
  • Price: Free download
  • Published: 1 March 2022*
  • Last Modified: 22 July 2024
  • File format: Text
  • Words: 3,324 (approx)
  • Number of pages: 14 (approx)
  • Tags: Gene editing essays

Text preview of this essay:

This page of the essay has 3,324 words.

CRISPR-Cas9 is a revolutionary tool for genome editing used in a variety of organisms because the RNA-guided Cas9 endonuclease enzyme can induce the generation of double-strand breaks (DSBs) in the genomic DNA. The cleavage of targeted DNA is controlled by Cas9 at a specific site that is complementary to the 20mer guide sequence of the guide RNA. Here, we use a pML104 vector with URA3 selectable marker for cloning of 20mer guide sequences and expressing Cas9 and guide RNA into the yeast cell for the genome editing. In addition, CRISPR-Cas9 and homology-directed- repair (HDR) allow the editing of the ADE2 genes in the Saccharomyces cerevisiae yeast. These results show that the CRISPR gene editing of ADE2 gene produces clearly identifiable phenotypes and also allows producing mutations and recovery of that mutants to wild type.

Keywords: Saccharomyces cerevisiae, Cas9, CRISPR, plasmids, guide RNA, genome editing, ADE2

Introduction

The Saccharomyces cerevisiae used as a powerful model organism with its clear genetic mechanisms well-described genomics, and several arrays of the biochemical assay (Howland 1996; Ju et al. 2011; Vidal and Fields 2014; Usaj et al. 2017). Yeast research has produced a better understanding of the fundamental mechanisms of cellular processes. For example gene expression and regulation, DNA damage and repair and protein degradation. It also facilitated the evolution of various techniques including DNA transformation protocol, genetic manipulation and bioengineering (Howland 1996; Vidal and Fields 2014; Usaj et al. 2017). However existing methods for the integration of particular mutations into the yeast genome remain monotonous, difficult and inefficient (Storici, Lewis, and Resnick 2001; Finney-Manchester and Maheshri 2013; Stuckey, Mukherjee, and Storici 2011) as they need specialized structures such as plasmid vectors, selectable markers that incorporates additional sequences having unwanted effects (Stuckey, Mukherjee, and Storici 2011; Finney-Manchester and Maheshri 2013).
The ability to provide accurate, mutations to the genetic material of living cells has been an important and somehow difficult task for genetic research mainly for eukaryotic organisms (Doudna and Charpentier 2014; Joung and Sander 2013; Pennisi 2013). Previous approaches involve the use of engineered nucleases, such as transcription activator-like effector nucleases (TALENS) designed to make double-strand breaks into targeted sites of DNA sites to recognize and make double-stranded breaks to alter any gene sequence (Pennisi 2013). A similar method is RNA silencing or RNA interference, which does not include any change to DNA sequence but it is commonly used the method to induce degradation of complementary messenger RNA before it could translate genes into protein (Kim and Rossi 2008; Shrivastava and Srivastava 2008). There are different limitations related with each method, depending on the nature of both the organism and gene being targeted.

The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 system is a revolutionary new gene-editing tool to alter the genomic sequences in numerous organisms from yeast to human (Mojica FJ, Diez-Villasenor C, Garcia-Martinez J 2005; Dicarlo et al. 2013; Gilbert et al. 2013). This technology has gained specialized use for direct manipulation of DNA sequences within targeted genes. The recent studies has shown that RNA-guided endonuclease Cas9 can be used to direct targeted to specific genomic locus to generate a double-stranded break, in particular, genomic locus (Carroll 2014) in various prokaryotic and eukaryotic cells, which permits the incorporation of precise changes (mutation) by giving a DNA template to repair double-stranded break by homologous recombination. This gene editing approach constructs the use of endonuclease enzyme called the Cas9, which is associated with a small “guide RNA” having sequence complementary to the target genome. With its target specificity and marker-free manipulation, the CRISPR-Cas9 system overcomes many existing restrictions and is becoming a more useful method for in vivo genetic manipulation (DiCarlo et al. 2013; Laughery et al. 2015; Bao et al. 2015; Horwitz et al. 2015).

To examine RNA-guided Cas9 nuclease activity, we designed a series of experiments to correct a mutation in a well-characterized yeast gene, Adenine2 (ADE2, a gene encoding a metabolic enzyme) with a metabolic defect (Ljungdahl and Daignan-Fornier 2012). The gene was edited to produce a nonfunctional product that results in distinct mutant phenotype indicated by red colored colonies and gene was repaired by adding repair template oligonucleotide. This CRISPR/Cas approach includes the cloning of the guide RNA (gRNA), which target Cas9 to particular chromosomal loci (Laughery et al. 2015), into the pML104 vector with distinctive Swal and BclI restriction sites. The system developed appeared to be more efficient, convenient and fast than many other CRISPR approaches in yeast (Baek et al. 2013; Jakočiūnas et al. 2015). The plasmid ought to be ligated overnight with oligonucleotides containing guide sequences then ligation products are transformed first into bacterial cells and cells are streaked over LB/Amp plates. The transformation of guide RNA into targeted cells is confirmed by PCR and to confirm the amplification, the PCR products can be resolved by gel electrophoresis. Then the plasmid constructed can be incorporated into yeast for effective genome editing (Laughery et al. 2015; DiCarlo et al. 2013).

Methods and materials

“All chemicals and reagents were supplied by Sigma Aldrich (UK) unless otherwise stated.

Generation of gRNA vector

The guide RNA expression plasmid pML104 was constructed which contained cas9 and distinctive BclI and SwaI restriction sites (Laughery et al. 2015). The plasmid was digested with SwaI (New England Biolabs) and 2µl BclI (New England Biolabs) was added to the digestion reaction and incubated for two hours at 58°C. After incubation, DNA was isolated from digest by using PCR purification kit according to the manufacturer’s instructions (Thermo Scientific GeneJET). Annealing of oligonucleotides was done by mixing 2µl of each oligonucleotide (Eurofins Genomics), forward (gADE2_f GATCTGGAAAAGGAGCCATTAACGGTTTTAGAGCTAG) and reverse oligonucleotide (gADE2_r TAGCTCTAAAACCGTTAATGGCTCCTTTTCCA) with 10µl 10× ligation buffer and 86µl of sterile water followed by heating at 90°C for 5 minutes and cooling at room temperature. The final concentration of annealed oligonucleotides was achieved by diluting with 150 µl of sterile water. A stock of digested vector pML104 containing cas9 gene and gRNA was used for cloning 20 nucleotides guide sequences.
For ADE2 gene targeting, 1µl diluted annealed oligonucleotides were mixed with 7µl of the digested purified vector, 1 µl 10× ligation buffer and 1µl of T4 DNA ligase Buffer (50mM Tris-HCl, 10mM MgCl2, 1mM ATP, 10mM DTT, pH 7.5). In the end, the ligation mixture was placed at 18°C in a water bath and further incubated there overnight, and then frozen (Figure 1).

Figure 1

The pML104 plasmid is digested with BclI and SwaI enzymes, followed by DNA purification and annealing of oligonucleotides. The purified plasmid is then ligated with oligonucleotides bearing guide RNA sequences.

Transformation of bacterial cells

The ligation product was transformed into bacterial cells as follows. Selective plates were prepared by adding 2g tryptone, 1g yeast extract, 2g NaCl and 4g agar into 200ml of water followed by autoclaving and media was cooled down at 50°C in water bath for 15 minutes. Ampicillin stock (100mg/ml in water) was prepared and added into the cool medium and distributed it properly, then poured on the Petri dishes. The labeled two 1.5ml Eppendorf tubes were used to place 9 µl of ligation mixture in on tube and 1 µl of the control plasmid DNA in a separate tube (to check either transformation worked in principle), then 100 µl of component cells (E. coli Top10 cells F- mcrA Δ (mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 nupG recA1 araD139 Δ (ara-leu) 7697 galE15 galK16 rpsL (StrR) endA1 λ-) were added to each tube and incubated on ice for 20 minutes. Both samples were placed in a 40°C water bath for 60 seconds, then placed back on ice and 1ml of liquid LB medium (1% Tryptone, 0.5% yeast extract, 1% NaCl in water) was added to each tube followed by incubation at 37 °C for 30 minutes. The bacterial cells were spun down at 3,000 rpm for 5 minutes and the liquid was removed only a drop of liquid left in the tubes to resuspend the cells by slowly pipetting up and down, then transferred onto plates and spread evenly by a plastic pipette. Plates were incubated at 37°C for 24 hours.

Verification of Clones by PCR

The clones of transformants obtained with ligation reactions either contained gRNA insert were verified by PCR as follows. 2ml of the overnight cultures of clones were transferred into 2ml Eppendorf tubes and after a spin at 13,000 rpm for 1 minute the medium was removed completely. The resulting cell pellet was further treated for DNA extraction using GeneJET plasmid miniprep kit according to the manufacturer’s instructions (Thermo Scientific) except in step 4; DNA was eluted with water instead of Elution buffer. After DNA extraction four PCR reactions with each of the DNA samples were prepared. To assemble the PCR reaction, following reagents were mixed together in 0.2ml of PCR tubes: 12.5ul GoTaq Master Mix; 1ul of already prepared DNA (mentioned above); 1ul of each of Primers 5’ (gADE2_f GATCTGGAAAAGGAGCCATTAACGGTTTTAGAGCTAG) and 3’ (g104_check CCGTGGTATCGTTTAGATTGGCAATTAC); sterile water to 25ul total volume and the tubes were placed in PCR machine for the completion of amplification cycle. The PCR reaction was performed as follows: an initial denaturation step at 105°C for 5 min, followed by 30 cycles of denaturation at 95°C for 45 seconds, annealing at 50°C for 45 seconds, and extension at 72°C for 5 min. While PCR was running the agarose gel was prepared by dissolving 0.75 g agarose in 7ml 1 x TAE (4ml of TAE buffer into 196ml of water to make up volume up to 200ml) then mixture was boiled in microwave for 1 minute at full setting, stirred and again boiled for 10 seconds to fully dissolve the agarose then 7.5μl of SYBR safe stain was added into it, stirred and poured agarose into the gel chamber. The comb was inserted for forming the pockets and left the gel to set. Completed PCR reaction was run on the agarose gel which could be loaded directly onto the gel, without adding sample buffer. After PCR reactions, 10ul of DNA ladder was loaded to judge the size of the product obtained. The gel was run at 60 V (current set to 200 mA) until the tracer dye had migrated about 2/3 of the gel length and the gel was visualized in the transilluminator.

Yeast Transformation for CRISPR Genome Editing

Yeast transformation for genome editing was performed as follows. Firstly, URA-plates were prepared by adding 2g glucose, 0.67g YNB (yeast nitrogen base), 0.19g URA dropout mixture and 2g agar into a 200ml bottle, to make up volume up to 100ml then autoclaved the mixture. After autoclaving, the mixture was let for cooling then cooled media was poured onto 4 plates and left to set the media.

Two samples of each yeast cells from BY471 (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0) culture and W303 (MATa leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11, 15) culture were prepared by spinning down 0.7ml of overnight cultures and supernatants were removed. On the top of the yeast cells, 355 ul of transformation mix was added. In one sample of each culture 3 ul of gRNA plasmid and 2 ul of water were added, and in other samples of BY4741 3 ul of control plasmid and 2 ul of water were added but in the second sample of W303 3 ul of gRNA plasmid and 2 ul repair template oligonucleotide (repAde2 CCAATGATCACGTTAATGGCTCCTTTTCCAATCCTCTTGATATCGAAAAACTAGCTGAAAAATGTGATGTGCTAACG) were added. To resuspend the cells in all four samples vortex was done for 1 minute. The mixtures were left at room temperature for 20 minutes and then incubated at 42°C for 20 minutes. The cells were centrifuged at 2000 rpm for 5 minutes followed by removing the supernatants, and the cells were resuspended in 200ul of water and streaked the cells onto -Ura plates, then yeast strains were incubated for 48 hours at 30 °C.

Verification of genome editing events

To test for ade2 mutants following CRISPR-Cas9 transformation, reference yeast strains were prepared by taking up a small number of yeast cells (a lump of ~1mm) from the colonies on the reference plates, and cells were resuspended in 1ml of sterile water. For the spot color assay, 5 ul drops of yeast culture were withdrawn onto a labeled ¼ YDP plate (2% glucose, 0.25% yeast extract, 1% Peptone in water). One drop for each of the BY4741 and W303 wells in the 96 well plate (96 well plates inoculated with edited colonies and reference samples and each plate was contained 12 BY4741 transformants, and 12 W303 transformants) and one drop from each of the resusupended reference samples were arranged on the plate sequence wise. The plate was left until all the liquid had soaked into plates then placed in the 30°C incubator.
For the growth assay, yeast cells were washed in water before spotting them onto a plate. 50 μl of each yeast culture of BY4741 and W303 from each well of the 96 well plates was placed in an Eppendorf tube. Following centrifugation for 1 minute at max speed, the supernatant was removed. The cell pellet was resuspended in 1 ml of sterile water. 5 ul drops of yeast culture were spotted in the same pattern as above but this time the SC –Ade (Formedium) plate was used (SC-Ade: 2% glucose, 0.67% yeast nitrogen base, 0.2% Kaiser Dropout mixture without adenine). For spectrophotometry assay 100ml of yeast extraction buffer (4.0g of NaOH in 100ml of water) was prepared and 400 ul of the NaOH solution was transferred in two Eppendorf tubes. Remaining yeast material from the reference plate was resuspended into the NaOH solution so that at the end one tube of BY4741 and one of W303 yeast strain were obtained, followed by incubation for 30 minutes and centrifugation for 2 minutes at max speed. The supernatants were into two photometer cuvettes. The absorption spectrum for the two samples was recorded between 350 and 600 nm wavelengths. The 5′-end of the targeted ADE2 gene locus of repaired yeast strains following CRISPR treatment was sequenced by following oligonucleotides: ADE2_up GCCGAGAATTTTGTAACACCAACATAACAC and ADE2_sta CTCAATCGTTAGCACATCACATTTTTCAGC. For amplifying the ADE2 gene, PCR was performed as follows: an initial denaturation step at 105°C for 5 min, followed by 30 cycles of denaturation at 95°C for 45 seconds, annealing at 50°C for 45 seconds, and extension at 72°C for 5 min and PCR product was sequenced by using primer (ADE2_up GCCGAGAATTTTGTAACACCAACATAACAC).

Results

The pML 104 vector was used for expressing the guide RNA: Cas9 in yeast. The specific guide RNA sequences can be cloned by recombing the diluted annealed oligonucleotides and ligation into the guide RNA vector. The oligonucleotides do not require any purification for providing efficient ligation. By using this approach, guide RNA sequences can be cloned easily and verified for CRISPR gene editing within a few days.

We tested the genome editing efficiency of the pML 104 vector by targeting the yeast ADE2 gene. Oligonucleotides which contain a 20mer guide sequence targeting the ADE2 gene were ligated into pML104 to create plasmid pML104. The ligation products were transformed into bacterial cells and a sample of intact plasmid DNA was also prepared to confirm the transformation. Confirmation of the transformants (either they received the gRNA insert) was done by PCR. PCR products were visualized by gel electrophoresis (Figure 2).

Figure 2

The PCR products obtained from the guide RNA plasmid mentioned above were visualized by gel electrophoresis (0.7% agarose gel). The first lane contains a 1 kb DNA ladder (M) and remaining lanes showing that transformants received the guide RNA insert (~150bp).
The sequencing of transformants confirmed the introduction of the guide RNA insertion. The sequenced gRNA plasmid was introduced into yeast strains of BY4741 and W303 to test the efficiency of the plasmid. One sample of yeast strain BY4741 (have the wild type ADE2 gene) was contained only gRNA plasmid and the other sample was contained control plasmid and water. The sample which contained gRNA plasmid showed random mutations in ADE2 gene, due to gRNA-mediated cleavage of the genomic DNA that lead towards random mutations in the gene via non-homologous end joining and red colored pigments appeared on Ura-plate. On the other hand, one sample of the W303 yeast strain was contained gRNA plasmid and water and other sample was contained gRNA plasmid with ADE2 repair template oligonucleotide. The first sample showed mutations as a result red colored colonies were observed on Ura-plate but the second sample was contained the gRNA plasmid, together with a single-stranded DNA oligonucleotide containing some of the wild type ADE2 sequences were introduced into the W303 yeast strain containing the non-functional ade2 gene. The genomic DNA was cleaved by gRNA plasmid and then it was repaired with the ADE2 oligonucleotide through homology-directed repair (HDR) (Figure 3).

Figure 3

Results from gRNA transformation: (A) White colonies appeared due to the presence of control gRNA plasmid; Red colonies display the random mutation in ADE2 wild type gene. (B) W303 strain displays the red colonies as a result of random mutations by gRNA plasmid on the first plate; second plate display more white colonies and few red colonies, the white colonies due to wild type ADE2 sequence plus homology-directed repair (HDR) as well as red color due to presence of non-functional ade2 mutants of W303.

The yeast colonies were analyzed for any change occurred in the ADE2 locus in the targeted cells. The reference yeast culture and yeast strain of BY4741 and W303 were first placed on the ¼ YDP plate for the spot color assay. The transformants of BY4741, which received random mutations in ADE2 gene, out of 12 transformants about 3 appeared as ade2 mutants, that were deprived of adenine with loss of normal gene function and showed red pigments on YDP media and other 9 cells were showed the normal ADE2 gene function. The transformants of W303 strain, which received both random mutations, by RNA-guide Cas9 that targeted the specific genomic locus to generate a break in DNA, which allows the induction of precise mutations and also provided a DNA template for homologous repair, as a result out of 12 transformants only 2 were recovered from mutant ade2 to normal gene functionality by CRISPR/Cas9 treatment. The transformants were then spotted on “SC -Ade” plate and only those transformants having edited ADE2 gene functions appeared on SC-Ade plate and only 2 transformants of W303 had the edited ADE2 gene (Figure 4). The desired targeted cells that carry the edited ADE2 gene were sequenced after PCR amplification.

Figure 4

The CRISPR editing events: the ¼ YDP plate, the red colored transformants display ade2 mutants, while white colored transformants had edited the ADE2 gene. On SC-Ade plate, only functional ADE2 transformants were able to grow.

In the end, to obtain the absorption spectrum of both yeast strains BY4741 and W303, they were resuspended in yeast extraction buffer and spectrum was recorded between 350nm and 600 nm (Figure 5).

Figure 5

The graph shows two absorption spectra of BY4741 and W303 yeast strains, the one with the red line is the spectrum for the W303 yeast transformants that carry ade2 mutations and treated by CRISPR/ Cas9 and blue line spectrum for BY4741 in which random mutations are introduced in ADE2 gene locus but the absence of repair template oligo.

Discussion

The strategy of CRISPR/ cas9 system in the yeast for targeting specific gene mutation in ADE2, that cause accumulation of an intermediate P-ribosylamino imidazole (AIR), which converted to form the red pigment during adenine biosynthesis in yeast. The CRISPR approach appeared significantly faster, convenient and efficient which involved cloning of 20mer guide sequence into the pML104 vector with unique SwaI and BclI restriction sites. The results presented here show that guide RNA sequences for CRISPR gene editing can b cloned and verified by PCR in a few days.

Our data show that all the transformants obtained after ligation reaction, received the guide RNA insert successfully, which used to cut the ADE2 gene at nucleotide 146. The efficiency of the pML104 plasmid in yeast strains BY4741 and W303 confirmed by the random mutations that appeared in both strains by gRNA-mediated cleavage of the genomic DNA and appearance of red colored colonies on Ura-plates confirm the desired mutations. While the sample of W303 that additionally contain repair template oligonucleotide have both edited ADE2 gene and few nonfunctional ade2 mutants observe clearly by white color colonies. The transfer of the edited transformants on the SC-Ade plate verified that the CRISPR/Cas system introduce the desired changes in ADE2 locus in the targeted cells but not all targeted cells received the treatment and some cells of W303 still have non- functional ade2 gene.

2019-1-20-1548001069

Discover more:

About this essay:

If you use part of this page in your own work, you need to provide a citation, as follows:

Essay Sauce, CRISPR gene editing of ADE2 gene (practical). Available from:<https://www.essaysauce.com/science-essays/crispr-gene-editing-of-ade2-gene/> [Accessed 15-08-26].

These Science essays have been submitted to us by students in order to help you with your studies.

* This essay may have been previously published on EssaySauce.com and/or Essay.uk.com at an earlier date than indicated.