2, 3′, 4, 4′, 5- Pentachlorobiphenyl Induces Inflammatory Responses in Thyroid through a JNK and Aryl Hydrocardon Receptor Mediated Pathway
Abstract
Polychlorinated biphenyls (PCBs) are persistent and widely distributed environmental pollutants that can compromise normal functions of multiple organs and systems, one important mechanism is the induction of inflammatory disorders. In this study, we investigated the effects of 2, 3′, 4, 4′, 5- Pentachlorobiphenyl (PCB118) on inflammatory responses and the underlying mechanisms in thyroid. Wistar rats were dosed with PCB118 intraperitoneally at 0, 10, 100 and 1000 ‘g/kg/day, 5 days per week for 13 weeks; rat thyroid FRTL-5 cells were treated with PCB118 (0, 0.25, 2.5, 25 nM) for indicated times. Results showed that PCB118 promoted the expression of interleukin-6 (IL-6), tumor necrosis factor-‘ (TNF-‘) and intercellular adhesion molecule-1 (ICAM-1) in time- and dose-dependent manner and decreased sodium/iodide symporter (NIS) protein. In vivo and in vitro studies also indicated that JNK pathway was activated after PCB118 exposure, and the experiments using small interfering RNA for JNK partially blocked PCB118’induced upregulation of IL-6 and ICAM-1, and downregulation of NIS. Moreover, pretreatment of thyroid cells with the aryl hydrocardon receptor (AhR) inhibitor ‘-naphthflavone (‘-NF) suppressed IL-6 and ICAM-1 and restored NIS expression. Taken together, PCB118 stimulates expression and secretion of IL-6, TNF-‘ and ICAM-1 in thyroid through activation of AhR and JNK, and subsequently interferes with NIS expression, resulting in disruption of the thyroid structure and function.
Keywords
Polychlorinated biphenyls 118; JNK pathway; IL-6, TNF-‘, ICAM-1; AhR; sodium iodide symporter; thyroid inflammation
Introduction
Polychlorinated biphenyls (PCBs) are ubiquitous synthetic organic pollutants that contaminate the environment. Due to their high lipophilicity and chemical stability, they are widely existed, and may biomagnify through the food chain and bioaccumulate in organisms. PCBs cause a variety of toxic effects, affecting immune, endocrine, nervous and reproductive system (Arnold et al. 1995; Golden and Kimbrough 2009; Portigal et al. 2002; Zhao et al. 2009). The majority of toxic effects elicited by coplanar PCBs are mediated by its binding to the aryl hydrocardon receptor (AhR), and subsequent induction of responsive genes (Barouki et al. 2007; Puga et al. 2009). In addition, one of the important mechanisms of PCBs toxicity is inflammation (Hennig et al. 2002; Imbeault et al. 2012; Kim et al. 2012). PCBs can induce inflammation in multiple systems and promote inflammatory cytokine levels such as interleukin-6 (IL-6), tumor necrosis factor-‘ (TNF-‘) and intercellular adhesion molecule-1 (ICAM-1) (Hayley et al. 2011; Koike et al. 2014).
Importantly, the thyroid axis appears to be susceptible to the influence of PCBs (Murk et al. 2013), and recent concerns have mainly focused on their thyroid hormone disturbance effects. Our early findings suggested that low concentrations of 2,3′,4,4’,5-pentachlorobiphenyl, or polychlorinated biphenyl 118 (PCB118), could disrupt thyroid structure, interfering with thyroid hormone and decreasing the pivotal gene expressions of sodium/iodide symporter (NIS) and thyroglobulin (TG) both in PCB118 treated rats and in cultured primary human thyroid cells (Guo et al. 2015; Tang et al. 2013a). However, it is not known whether inflammation would play a role in these adverse effects of PCBs. A few studies indicated that environmental pollutants, especially PCBs, are potential contributors to the development of autoimmune thyroiditis (Langer et al. 2007; Molina and Ehrenfeld 2003; Prummel et al. 2004), whereas the underlying mechanisms remain to be elucidated. Autoimmune thyroiditis (AIT), known as an inflammatory state of the thyroid, is characterized by intrathyroidal lymphocytic infiltration, and positive serum anti-thyroglobulin (TGAb) and/or anti-thyroid peroxidase antibodies (TPOAb) (Davies and Amino 1993). Pro-inflammatory cytokines are involved in the pathogenesis of autoimmune and proliferative thyroid disorders (Ajjan et al. 1997; Ajjan and Weetman 2003; Mikos et al. 2014). They are produced by immune cells as well as thryocytes and lymphocytes (Ajjan et al. 1996; Boutzios and Kaltsas 2015). Activated thyrocytes have the ability to produce various types of cytokines and adhesion molecules including interleukin-1 (IL-1), interleukin-6 (IL-6), tumor necrosis factor-alpha (TNF-‘), transforming growth factor beta (TGF-‘) and intercellular adhesion molecule-1 (ICAM-1) (Aust and Scherbaum 1996; Chung et al. 2000; Mori et al. 2005; Szabo-Fresnais et al. 2008), exhibiting inhibitory effects of sodium/iodide symporter (NIS), a membrane protein which mediates the intracellular accumulation of iodine into thyrocytes (Schumm-Draeger 2001). Moreover, inflammatory cytokines could cause local vasodilatation of the thyroid, increasing permeability of vascular endothelium and tissue liquid exudation, resulting in thyroid dysfunction and structure disruption (George and Chrousos 1995).
Here, we demonstrate both in vivo and in vitro that low-dose PCB118 could promote the expression of IL-6, TNF-‘ and ICAM-1 in thyroid cells, inducing thyroid inflammation and dysfunction through the activation of JNK pathway, and that such effects are mediated by the AhR.
Methods and materials
Materials. Coon’s modified Ham’s F-12 medium, transferrin, bovine insulin, hydrocortisone, somatostatin, glycyl-L-histidyl-L-lysine acetate, and bovine TSH were purchased from Sigma-Aldrich (USA). Newborn calf serum was obtained from Gibco (USA). Antibiotics were from HyClone (USA). PCB118 (purity, 100%), obtained from AccuStandard (USA), was dissolved in dimethyl sulfoxide (DMSO) and maintained as a 25 mM stock solution in the dark. ‘-Naphthoflavone (??-NF) was obtained from Sigma Aldrich (USA), and dissolved in DMSO as a 100 mM stock solution in -20 ??C.
Cell culture and treatment. The rat thyroid cell line, FRTL-5 cells, were a gift from Dr. Zheng Xuqin (Department of Endocrinology, First Affiliated Hospital of Nanjing Medical University) (Zheng et al. 2010), and the cells were kindly provided to her by Professor Michael Derwahl (Department of Medicine, St. Hedwig Hospital) (Lan et al. 2007). FRTL-5 cells were cultured as we previously described (Yang et al. 2015), and incubated at 37??C in 5% CO2, passaged every 7-10 days. Cells were treated with indicated concentrations of PCB118 (0.25-25 nM) or DMSO (0.1% v/v) as a control. The selection of the low concentrations of PCB118 was based on our early viability and apoptosis assays, ranging from 0.25 to 25 nM, at which the cell viability and apoptosis were not affected (Yang et al. 2015).
Quantitative real-time polymerase chain reaction (qRT-PCR). FRTL-5 cells were plated in six-well plates (2ml, 1.6’105 cells/well), and allowed to adhere for 24 h at 37??C. Cells were then treated with PCB118 at concentrations of 0.25, 2.5, 25 nM or DMSO for 24 h. Total RNA was extracted from FRTL-5 cells or rat thyroid tissues using RNAiso Plus (Takara, Japan) per the manufacturer’s directions, and reverse transcribed using the PrimeScript?? RT Master Mix Kit (Takara). Quantitative RT-PCR was conducted by SYBR-Green PCR kit protocol using the Step One Plus system (Applied Biosystems, USA). The amplication of ??-actin was served as an internal control. Relative expression levels of target genes were calculated using the 2 ”?CT method. Sequences of the primers we used are listed in Table 1. All primers were synthesized by Takara.
Western blotting. FRTL-5 cells were cultured in six-well plates (2 mL, 1.5??105 cells/well) and treated with PCB118 or DMSO for 48 h for protein isolation. Proteins from FRTL-5 cells or rat thyroid tissues were extracted with a protein extraction kit (KeyGEN Biotech, China) according to the manufacturer’s protocol. Protein concentrations of the samples were determined using a BCA protein assay kit (Beyotime Biotech Inc., China). Equal amounts of protein (30 ??g/lane) were separated by 10% SDS-PAGE, followed by electrotransfer onto a polyvinylidene fluoride membrane (Thermo Scientific). The membranes were blocked for 2 h with 5% nonfat milk at room temperature and then incubated with primary antibodies overnight. Protein visualization was performed using an enhanced chemiluminescence reagent (Thermo, USA). Antibodies against JNK, p-JNK, c-jun, p-c-jun (Ser 63), P38, p-P38 and GAPDH were purchased from Cell Signaling Technology (USA), all were of rabbit origination, 1:1000 dilution. Rabbit anti-ICAM-1 and mouse anti-NIS antibody were obtained from Santa Cruz, 1:200 dilution.
Enzyme ‘lined immunosorbent assay (ELISA).
IL-6 and TNF-‘ from cell supernatants were detected in duplicate according to the manufacture’s directions with highly sensitive enzyme-linked immunosorbent assay (ELISA) kits containing Raybiotech-ELR-IL6 and ELR-TNF-alpha (USA), respectively.
Small interfering RNA (siRNA) transfection. To selectively silence JNK gene expression, JNK1/2-targeting siRNA was performed. The siRNA sequences targeting rat JNK1 was 5′- GGUGCAUUAUGGGAGAAAUTT-3′, JNK2 was 5′- CCAGCAGUUGAAACCAAUUTT-3’, synthesized by GenePharma. FRTL-5 cells were seeded in six-well plates and after 24 h were transfected with JNK1/2 siRNA or non-target siRNA (negative control, NC) (the final concentration of siRNA was 50 nM) using Lipofectamine 2000 (Invitrogen). 6 h later, cells were changed with complete media. After 24 h, transfected cells were treated with 25 nM PCB118 or DMSO (0.1% v/v). Cell lysates were extracted 24 h or 48 h later to isolate RNA or protein, separately. The efficacy of JNK1/2 knockdown was verified by western blot analysis.
Aryl hydrocarbon receptor (AhR) inhibitor treatment. Cells were cultured in six-well plates to 60%-70% confluence. They were then pre-treated with 5’M ‘-naphthflavone (‘-NF) or DMSO for 1 h, followed by stimulation with PCB118 or DMSO for 24 or 48 h to extract total RNA or protein, separately.
Animal treatment and sample collection. Forty male Wistar rats (6-8 weeks old) were purchased from Vital River (Beijing, China). Animals were kept under standard conditions in a 12 h light/dark cycle with free access to food and water. After one week acclimation, rats were randomly divided into four groups, and administered vehicle (corn oil, 0.5 ml/kg/d) or PCB118 at 10, 100, 1000 ‘g/kg/d by intraperitoneal (i.p.) injection, 5 days a week for 13 weeks. Body weights were measured daily. At the study end point, rats were euthanized with an overdose of i.p. chloral hydrate, and the thyroid gland were removed to liquid nitrogen and stored at -80??C until use or fixed in 4% paraformaldehyde. All animals received humane care and studies have been approved by the Institutional Animal Care and Use Committee.
Histology. Thyroids were fixed in 4% paraformaldehyde overnight, embedded in paraffin, and cut in serial sections (4 ‘m). Sections were deparaffinized and stained with hematoxylin and eosin (HE) and observed under light microscope.
Immunohistochemistry. Sections of 4 ‘m thick were blocked at 60 ??C for 1 hour, deparaffinized with xylenes, and rehydrated using graded ethanol and distilled water. Antigen retrieval was conducted using citrate buffer. Endogenous peroxidase was quenched with 3% H2O2 in methanol for 30 min. Then tissues were blocked with 1% bovine serum albumin and incubated with primary antibodies of IL-6 (Abcam, 1:300), TNF-‘ (Bioworld, 1:150), ICAM-1 (Proteintech, 1:50), and p-JNK (Cell Signaling Technology (USA), 1:50) overnight at 4 ??C, followed by horseradish peroxidase-conjugated goat anti-rabbit or goat anti-mouse IgG (Bioworld).
Statistical analysis. Data are expressed as mean ‘ standard error of the mean (SEM), for at least three independent experiments. The SPSS 19.0 (SPSS Inc., Chicago, IL, USA) was used to analyze t-test and one-way analysis of variance (ANOVA), followed by Dunnett’s post-hoc test. P value < 0.05 was considered statistically significant.
Results
Effects of PCB118 on body weight and cell viability
No clinical signs of toxicity or morbidity were observed among animals following exposure to PCB118. There were no significant differences in body weight among PCB118 and vehicle control groups (data not shown). Additionally, at the concentrations of 0.25-25 nM, FRTL-5 cell viability and apoptosis were not affected as determined by our previous viability and apoptosis assays (Yang et al. 2015).
PCB118 affects thyroid histomorphology
Dose-dependent histomorphological changes were observed in PCB118-treated rat thyroids, including hyperplasia and expansion of follicle cells, shedding of epithelial cells, follicle collapse, colloid deficiency, and marked interstitial inflammatory cell infiltration. Mesenchymal fibrosis and even fibrinoid necrosis were observed in 100 and 1,000 'g/kg/d groups (Fig. 1).
PCB118 promotes the expression of pro-inflammatory factors in thyroid both in vivo and in vitro
PCB118 exposure resulted in increased IL-6, TNF-' and ICAM-1 mRNA in rat thyroid in 100 and 1000 'g/kg/d dose groups (P<0.05). However, no significant changes were observed in the 10 'g/kg/d group (P>0.05) (Fig. 2). The immunohistochemical staining analysis of IL-6, TNF-‘ and ICAM-1 in rat thyroid tissues revealed similar results (Fig. 3).
To verify the induction of inflammatory cytokines by PCB118, FRTL-5 thyroid cells were treated and analyzed in vitro. As shown in Fig. 4, after stimulation with PCB118 for 24 h (for qRT-PCR) or 48 h (for western blot and ELISA analysis), both mRNA (Fig. 4A) and protein (Figs. 4B,C) levels of IL-6, TNF-‘ and ICAM-1 increased significantly. Cells were treated with DMSO or PCB118 (25 nM) for various time intervals ranging from 6-48 hours. As shown in Fig. 4D, mRNA expressions of TNF-‘ reached peak at 12 hours, while IL-6 and ICAM-1 mRNA levels peaked at 24 hours. Significant increases in protein levels of all three factors were observed at 24 and 48 hours, and ICAM-1 protein expression maximized at 48 hours (Fig.4E, F). Altogether, these results suggest that PCB118 promotes thyroid inflammation in time- and concentration- dependent way.
PCB118 activates JNK pathway in thyroid in vivo and in vitro
MAPKs play important roles in cellular responses to environmental stress and inflammation. Among them, JNK and P38 are important mediators of inflammation and cytokine expression. In order to determine whether PCB118 had a role in MAPK activation, we assessed phosphorylation of JNK and P38 in FRTL-5 cells. As shown in Fig. 5, treatment with PCB118 significantly increased phosphorylation of JNK (p-JNK) in FRTL-5 cells. However, there were no differences in P38 phosphorylation or total levels of JNK and P38 between PCB118 and DMSO control groups. Additionally, we explored the expression of c-jun, a downstream factor of JNK pathway, and found that PCB118 at 25 nM also significantly increased the phosphorylation of c-jun expression in FRTL-5 cells.
We further confirmed the activation of JNK pathway by PCB118 in vivo. Levels of p-JNK increased significantly at 100 and 1000 ‘g/kg/d groups (Fig. 6). Similar results were found in the immunohistochemical analysis (Fig. 7).
PCB118 promotes the expressions of IL-6 and ICAM-1 in FRTL-5 cells via the JNK pathway
To investigate whether the activation of JNK pathway play a role in the promotion of inflammatory cytokines, we inhibited JNK pathway. Since extensive evidence has revealed that MAPK inhibitors may cross-react with AhR (Bachleda and Dvo’?k 2008; Dvorak et al. 2008; Joiakim et al. 2003), we used small interfering RNA targeting JNK (siJNK) instead. The siJNK dramatically inhibited JNK and p-JNK protein expression (Fig. 8A). Treatment with siJNK significantly blocked PCB118-induced IL-6 and ICAM-1 mRNA expression, and restored NIS protein expression. However, siJNK had no effect on PCB118-induced TNF-‘ expression. Taken together, these data suggest that PCB118 could promote thyroid inflammatory responses, and lead to thyroid dysfunction, which were mediated through the JNK pathway.
PCB118-induced expressions of IL-6 and ICAM-1 in FRTL-5 cells are mediated by AhR
Coplanar PCBs, for example, PCB118, exert most of their effects through AhR. To test the role of AhR in inflammatory responses by PCB118, the AhR antagonist ‘- naphthflavone (‘-NF) was used. Pretreatment with ‘-NF inhibited PCB118-induced IL-6 and ICAM-1 mRNA expression, and increased NIS protein expression, suggesting that PCB118 could regulate the inflammatory pathway and cause thyroid dysfunction via the AhR. However, the induction of TNF-‘ by PCB118 was not affected by ‘-NF.
Fig. 1. PCB118 affected thyroid histomorphology. HE stainings were used to analyze PCB118-exposured thyroids. (A) Control group. (B) PCB118 (10 ‘g/kg/d group). (C) PCB118 (100 ‘g/kg/d group). (D) PCB118 (1000 ‘g/kg/d group). Arrows indicate inflammatory cell infiltration. Magnification: 200’.
Fig. 2. Effects of PCB118 on IL-6, TNF-‘ and ICAM-1 mRNA expression levels in rat thyroid tissue measured by quantitative real-time PCR. Data are expressed as mean ‘ SEM of at least three independent experiments. * P < 0.05, ** P < 0.01, compared to vehicle control.
Fig. 3. Representative immunohistochemical images of IL-6, TNF-' and ICAM-1 in rat thyroids after 13 weeks of i.p. vehicle or PCB118 (10, 100, 1000 'g/kg/d) administration. Brown indicated IL-6, TNF-' and ICAM-1 positivity. Magnification: 400'.
Fig. 4. PCB118 up-regulates IL-6, TNF-' and ICAM-1 in FRTL-5 cells in concentration- and time-dependent manner. A-C, cells were treated with various concentrations of PCB118 (0, 0.25, 2.5, 25 nM) for 24 h (qRT-PCR) or 48 h (ELISA and western blotting). D-F, cells were treated with PCB118 (25 nM) for indicated time periods ranging from 0-48 h. Total RNA was isolated for qRT-PCR of IL-6, TNF-' and ICAM-1 (A, D). Cell supernatants of IL-6 and TNF-' were detected using ELISA (B, E). Whole cell lysates were analyzed by western blotting using antibodies recognizing ICAM-1 (C, F). Results represent mean ?? SEM of at least 3 experiments. * P < 0.05, ** P < 0.01, compared to vehicle control.
Fig. 5. JNK pathway was activated in PCB118 treated FRTL-5 cells. Cells were treated with various concentrations of PCB118 (0, 0.25, 2.5, 25 nM) for 48 h for Western blotting. Data are expressed as mean' SEM of at least three independent experiments. The relative ratio of target protein/GAPDH was set as 1. * P < 0.05, ** P < 0.01, compared to vehicle control.
Fig. 6. PCB118 activated JNK pathway in rat thyroid tissue. Rats (n=10/group) were treated by i.p. with PCB118 (0, 10, 100, 1000 'g/kg/d) for 13 weeks. Data are expressed as mean' SEM of at least three independent experiments. The relative ratio of target protein/GAPDH was set as 1. * P < 0.05, ** P < 0.01, compared to vehicle control.
Fig. 7. Representative immunohistochemical images of phospho-JNK in rat thyroid tissue after 13 weeks of i.p. PCB118 (0, 10, 100, 1000 'g/kg/d) administration. Brown indicated p-JNK positivity. Magnification: 400'.
Fig. 8. JNK pathway plays a role in PCB118 induced up-regulation of inflammatory cytokines and down-regulation of NIS expression in FRTL-5 cells. JNK was knocked down by JNK1/2-siRNA in FRTL-5 cells, and the cells were treated with PCB118 at 25 nM. Whole cell lysates were analyzed by western blotting using antibodies recognizing JNK, p-JNK and NIS (A and C). IL-6, TNF-' and ICAM-1 mRNA expression levels (B) were measured using Real-time PCR. Results represent mean ?? SEM of 4 experiments. * P < 0.05, compared to DMSO control group transfected with the non-targeting negative control (NC) plasmid. # P < 0.05, compared to PCB118-treated group transfected with the NC siRNA.
Fig. 9. PCB118 induced up-regulation of inflammatory cytokines and down-regulation of NIS expression in FRTL-5 cells is AhR-dependent. Cells were pre-treated with the AhR antagonist ??-naphthoflavone (NF, 5 ??M) or dimethyl sulfoxide (DMSO) for 1 h followed by DMSO or PCB118 (25 nM) treatment for (A) 24 h for Real-time PCR analysis of IL-6, TNF-' and ICAM-1 mRNA expression levels, and (B) 48 h for Western blotting analysis of NIS protein expression. * P < 0.05, compared to NF control group. # P < 0.05, compared to PCB118-treated group.
Discussion
PCBs are typical persistent organic pollutants that interfere with multiple organ systems (Arnold et al. 1995; Golden and Kimbrough 2009; Portigal et al. 2002; Zhao et al. 2009). A growing body of evidence suggests that PCBs can promote multiple inflammatory disorders including liver and endothelial cells (Hennig et al. 2002; Wahlang et al. 2014). Our previous study demonstrated that chronic exposure to low doses of PCB118 could disrupt thyroid structure, significantly decreasing serum levels of thyroid hormones (Tang et al. 2013a). Moreover, the expressions of thyroglobulin (TG) and NIS, two critical functional genes determining thyroid hormone synthesis and secretion, were inhibited in rat thyroid. However, it is unclear whether inflammation would be an underlying mechanism of PCB118-induced thyroid disruption. In the present study, we showed that low dose PCB118 could promote inflammatory responses, thereby causing changes in thyroid morphology and function, and that these effects are mediated by AhR as well as the activation of JNK/MAPK pathway.
Accumulating evidence supports the theory that low-grade inflammation plays a role in the changes of thyroid structure and function (Chen et al. 2013). Thyroid disorders, including thyroid cancer and autoimmune thyroid diseases, have been closely related to inflammation (Bozec et al. 2010; Provatopoulou et al. 2014). The thyroid axis is activated in response to inflammation and infection by inflammatory cytokines, which are mainly generated by immune cells, but are also released from thyroid follicular cells and inflammatory cells (Ajjan et al. 1996; Boutzios and Kaltsas 2015). Impaired thyrocytes can express various cytokines that are involved in the pathogenesis of thyroid disease by affecting both the immune system and directly influencing the thyroid follicular cells (Mikos et al. 2014). Our present study showed that PCB118 increased the levels of IL-6, TNF-', and ICAM-1 both in FRTL-5 cells and rat thyroid tissue. In addition, PCB118 decreased the expression of NIS protein, severely damaging thyroid structure, accompanied by interstitial inflammatory cells infiltration. To some extent, these results are consistent with our previous findings that PCB118 promoted serum levels of thyroglobulin antibody (TGAb) and thyroid peroxidase antibody (TPOAb) (Tang et al. 2013b), indicating the activation of autoimmune thyroid disorders. Since patients with autoimmune thyroid disease (especially Hashomoto's thyroiditis and surgically treated Graves' diseases) are likely to develop hypothyroidism, it may be concluded that inflammatory disorders are involved in the thyroid dysfunction by PCB118.
Previous reports have shown that the nuclear factor 'B (NF-'B) and P38 or JNK MAPK pathways are activated by PCBs during inflammatory responses in various organ systems (Kwon et al. 2002; Majkova et al. 2009). However, in our pre-experiment work, we didn't find changes in NF-'B levels. Activation of MAPKs is a prominent intracellular signaling event in response to environmental stimuli. Particularly, JNK and P38 are important mediators of inflammation and cytokine expression (Cesaris et al. 1999; Kaminska 2005). Additionally, JNK activation has been demonstrated to be involved in PCB-induced thyroid dysfunction (Liu et al. 2012a). To determine whether PCB118 could induce MAPKs activation, we assessed phosphorylation of JNK and P38 in thyroid cells. We found that JNK, but not P38, was activated by PCB118 in thyroid cells both in vivo and in vitro. In addition, the effect of PCB118 on the expressions of IL-6 and ICAM-1 could be inhibited by siJNK in FRTL-5 cells and NIS expression was restored. These findings demonstrate that PCB118-induced thyroid dysfunction can be attributed to inflammatory responses via the activation of JNK pathway. However, the increased TNF-' level induced by PCB118 was not affected by siJNK, suggesting that a different pathway may exist for PCB118 to promote the release of TNF-' in FRTL-5 cells. It was reported that TNF-' could activate JNK and P38 pathway, and then promote the expressions of pro-inflammatory cytokines and adhesion molecules such as IL-6, ICAM-1 and VCAM-1 (Cesaris et al. 1998; Cesaris et al. 1999; Liu et al. 2012b), suggesting that TNF-' activation exists in the upstream rather than the downstream of JNK pathway. This may possibly explain our results as in our study, TNF-' mRNA and protein expressions occurred earlier than IL-6 and ICAM-1 (Fig. 4).
The aryl hydrocarbon receptor (AhR) has been demonstrated as an important mediator in PCBs-induced inflammatory processes (Kim et al. 2012). For example, IL-6 and VCAM-1 have been induced only by coplanar PCBs that are AhR ligands and in wide-type mice but not in AhR knockout mice (Hennig et al. 2002). In this study, we used the antagonist of AhR, '-Naphthoflavone ('-NF), to evaluate the role of AhR in PCB118-caused inflammatory response. Our results suggest that IL-6 and ICAM-1 are induced by PCB118 in an AhR-dependent way. However, further studies are needed to assess the mechanisms of PCB118-induced TNF-' production because it is not AhR-dependent.
The activation of JNK may be associated with AhR. This association is possibly dependent on the specific ligand and cell or tissue type (Puga et al. 2009). Previous reports have demonstrated that AhR ligands activate JNK, P38 and ERK through an AhR-dependent manner in hepatocytes, ovarian and breast cancer cells (Callero et al. 2013; Diry et al. 2006; Xu et al. 2013). Moreover, in the absence of AhR, TCDD could not activate P38 in rat and mouse hepatoma cells (Weiss et al. 2005), confirming the key role of AhR in TCDD-induced MAPKs activation. In contrast, reports also showed that PCBs-stimulated MAPKs does not require AhR (Puga et al. 1992; Tan et al. 2002). In these studies, JNK activation occurred in less than 2 hours after TCDD treatment, representing an early and transient response to TCDD. However, it was proposed that the AhR might not be involved in the earlier events (<1-2 hr) of TCDD exposure, but may have an effect at later times (Puga et al. 1992), and that Diry et al. (2006) also demonstrated this point in their study when treating cells for 48 h and showed an AhR-dependent JNK activation. In this study, PCB118-induced upregulation of IL-6 and ICAM-1 and downregulation of NIS was dependent on not only JNK (Fig. 8) but also AhR (Fig. 9), although we did not confirm the interactions between AhR and JNK in the current study. In our study, PCB118 incubation time was 24 or 48h, these time intervals are relatively long and are in accordance with that of Diry et al., which represent slower and persistent effects of PCBs. From the present study and those of previous reports, it may be speculated that the binding of PCB118 to AhR leads to the activation of JNK pathway, subsequently resulting in the upregulation of IL-6 and ICAM-1, and downregulation of NIS. However, further studies are needed to confirm the association between AhR and JNK.
In conclusion, the present study demonstrated that low concentrations of PCB118 could promote the inflammatory responses in the thyroid, thereby leading to abnormal thyroid structure and function, and that such effects can be attributed to, at least in part, the AhR and the activation of JNK pathway.
Table 1 Primers used for quantitative real-time PCR
Primer Primer sequences (5 to 3) Genbank
IL-6 Forward: CGAAAGTCAACTCCATCTGCC
Reverse: GGCAACTGGCTGGAAGTCTCT NM-012589.2
TNF-' Forward: CCAGGAGAAAGTCAGCCTCCT
Reverse: TCATACCAGGGCTTGAGCTCA NM-012675.3
ICAM-1 Forward: GCTTCTGCCACCATCACTGTGTA
Reverse: ATGAGGTTCTTGCCCACCTG NM-012967.1
?? - actin Forward: GGAGATTACTGCCCTGGCTCCTA
Reverse: GACTCATCGTACTCCTGCTTGCTG NM-031144.3
Essay: Polychlorinated biphenyls (PCBs)
Essay details and download:
- Subject area(s): Science essays
- Reading time: 7 minutes
- Price: Free download
- Published: 27 November 2015*
- Last Modified: 18 September 2024
- File format: Text
- Words: 1,841 (approx)
- Number of pages: 8 (approx)
Text preview of this essay:
This page of the essay has 1,841 words.
About this essay:
If you use part of this page in your own work, you need to provide a citation, as follows:
Essay Sauce, Polychlorinated biphenyls (PCBs). Available from:<https://www.essaysauce.com/science-essays/essay-polychlorinated-biphenyls-pcbs/> [Accessed 15-09-26].
These Science essays have been submitted to us by students in order to help you with your studies.
* This essay may have been previously published on EssaySauce.com and/or Essay.uk.com at an earlier date than indicated.