Home > Science essays > Screening For Polymorphism In Exon 12, Usp9Y Gene Of Azoospermic Patients

Essay: Screening For Polymorphism In Exon 12, Usp9Y Gene Of Azoospermic Patients

Essay details and download:

  • Subject area(s): Science essays
  • Reading time: 4 minutes
  • Price: Free download
  • Published: 17 June 2012*
  • Last Modified: 23 July 2024
  • File format: Text
  • Words: 1,152 (approx)
  • Number of pages: 5 (approx)

Text preview of this essay:

This page of the essay has 1,152 words.

Screening For Polymorphism In Exon 12, Usp9Y Gene Of Azoospermic Patients

Azoospermic patients are reported to have either complete or partial deletions of USP9Y gene ecoding Ubiquitin specific peptidase 9, Y-linked (USP9Y) enzyme, located on the q arm of Y chromosome. The gene is known to be involved in normal spermatogenesis; however, its function is not well understood. In this study, we amplified a specific region of exon-12 of USP9Y gene from 23 azoospermic patients using polymerase chain reaction and then PCR products were screened for polymorphism using single strand conformation polymorphism (SSCP). SSCP analysis showed band variation in one azoospermic patient.
Keywords: Azoopermic, USP9Y, PCR, SSCP, Polymorphism

I. INTRODUCTION
The USP9Y gene is located on AZFA region of the long (q) arm of the Y chromosome at position 11.2. Out of 792 kb span of AZF interval, 170 kb is spanned by USP9Y gene which consists of 46 exons (Hall et al). USP9Y gene encodes Ubiquitin specific peptidase 9, Y-linked enzyme and is a member of the peptidase C19 family. This protein is known to play an important role in normal human spermatogenesis, although its precise function is not known. Complete or partial loss of USP9Y gene and single nucleotide polymorphisms have shown to result in severe Sertoli-cell-only phenotype with no visible germ cells [1, 2]. It may be either due to an early defect in germ cell progression, or germ cell degeneration which lead to blockage in spermatogenic progression [3]. Azoospermia and severe oligospermia have been associated with deletion in USP9Y patients [8]. USP9Y gene, therefore, could be linked with proper spermatogenesis progression in humans.
In this study, we planned to screen for any mutation in exon-12 of USP9Y gene in azoospermic patients.
II. MATERIALS AND METHODS
A. Patients and controls
23 azoospermic men and 1 fertile male control samples were recruited from Sandya fertility centre, Vellore for present study. Blood samples were collected in EDTA vacutainers from all the patients. The age groups of azoospermic men ranged from 25 to 40 years. With the help of an experienced Gynaecologist a detailed case history and clinical examination of every patient were carried out. The life styles and habits of the patients were recorded including smoking and alcohol drinking as Presented in table 1. Semen analysis was routinely performed on the male partner of couple coming for infertility treatment. After semen analysis only confirmed Azoospermia cases were included in this study. Blood samples from each azoospermic patient were collected by the Physicians with the written consent.


B. DNA extraction:
4 ml of intravenous blood was sampled from all the patients using EDTA coated vaccutainer. The genomic DNA was extracted from peripheral blood by using [4] Qualitative analysis of DNA was carried out by 0.8% Agarose Gel Electrophoresis (Fig.1).
C. PCR Analysis:
The polymerase chain reaction (PCR) technique was used to amplify the SNP bearing region of Exon-12 of USP9Y gene on the long arm of Y chromosome with a pair of primers sequence; Forward primer and reverse primer:
FP: (5′ GCAGGAAAACATGAAGCCAT 3′), RP:(3’CAATGACCAATTCTTTTTCATCA5′). The PCR product size was 258 base pair (bp). The lyophilized primers were ordered and received from the company (Merck, Bangalore). Polymerase chain reaction consisted of 20??l PCR reaction mixture and included 5??l 2x Red mix PCR buffer, 0.5??l of 2 picomol (pm) each forward and reverse primer, 9??l of autoclaved MilliQ water and 4??l 10ng of genomic DNA. The Red mix 2x PCR reagents was purchased from Synergy Scientific Services (Chennai). Preparation of PCR Master Mix is presented in table 2. Each sample was amplified separately in a 0.2 mL thin wall tube using an Applied Biosystems?? Veriti?? 96-Well Thermal Cycler, USA. A PCR condition used for STS marker was as follows: initial denaturation (95??C for 5 min), subsequent denaturations (95??C for 30 sec) and extension (72??C for 40 sec) The annealing temperatures that were used for Exon-12 of USP9Y gene was 57??C for 30sec and final elongation was (72??C for 5min). PCR condition is presented in table.3. To confirm the amplification of Exon-12 of USP9Y gene of AZFa region on Y-chromosome, the PCR products were checked by electrophoresis in a 2% agarose gel containing ethidium bromide (0.5 mg/ml) and the bands visualized under UV illumination and photographed (Fig.2).

Table 2: Preparation of PCR Master Mix amplification of Exon- 12 of USP9Y gene on Y-Chromosome.
Content Quantity
2X Master Mix- Red 5??l
Forward Primer 0.5??l
Reverse Primer 0.5??l
MilliQ Water 10??l
Master mix + DNA 16??l + 4??l
Total 20??l/sample

Table 3: PCR Conditions for amplification of Exon 12 of USP9Y gene on Y-Chromosome

Steps of PCR Conditions
Initiation 95’C for 5 minutes
Denaturation 95’C for 30 seconds
Annealing(standardized at) 57’C for 30 seconds
Elongation (Initial Extension) 72’C for 40 seconds
Final Extension 72’C for 5 minutes
Hold 4’C
D. Single Strand Conformation Polymorphism (SSCP)
SSCP (Single Strand Conformation Polymorphism) of the PCR product was carried out to find out to screen the samples for the suspected mutation in Exon- 12 of USP9Y gene. 8??l of PCR products were used for SSCP which was performed by the modified and standardized protocol of Orita et al. [5]

III. RESULTS
DNA was isolated from all the 23 azoospermic cases and control samples. Qualitative analysis of extracted DNA were checked in 1.5% agarose gel and presented in figure.1. The annealing temperature of PCR amplification was standardized at 57??C using gradient PCR technique. SNP bearing region of Exon-12 of USP9Y gene on Y chromosome was amplified for all the 23 cases of azoospermic patients as shown in figure 2. PCR products was analysed using SSCP to screen for polymorphism in the azoospermic patients. Band variation was seen only in sample AY19 in the SSCP analysis in which polymorphism can be confirm by sequencing.

Fig.1: Qualitative analysis of extracted DNA of Azoospermia patients on 1% Agarose Gel Electrophoresis.

Lane1: Control, Lane 2-5: Azoospermic patient samples.
Fig 2: 2% Agarose gel showing the PCR amplification of SNP bearing region of Exon-12 of USP9Y gene in azoospermic patients.

L1: Control, L2-L6: Azoospermic patient sample,
L7:100 bp ladder.
Fig 3: SSCP gel indicating presence of band variation in patient samples.

L1: Control, L2-L7: Azoospermic patient sample where L5 shows band variation.

IV. DISCUSSION
De novo mutation in USP9Y gene causes spermatogenic failure due to formation of truncated protein. This mutation was associated with nonobstructive azoospermia [2]. The USP9Y gene was considered as one of the major Y-linked spermatogenesis genes, both for its position (AZFa region) and the previously reported genotype’phenotype correlation (infertility due to severe spermatogenic failure). But its exact role in spermatogenesis is still not known. Technological progresses in molecular genetics and data from animal model and the human genome project will be an excellent background for a large scale research in the field of genetics of male infertility

V. CONCLUSION
In our samples, only one sample showed band variation in SSCP analysis. This suggest that in this sample, there might be mutation in exon 12 while the other samples might be having mutation in different region of AZF region of Y chromosome which led to azoopermia in them.

About this essay:

If you use part of this page in your own work, you need to provide a citation, as follows:

Essay Sauce, Screening For Polymorphism In Exon 12, Usp9Y Gene Of Azoospermic Patients. Available from:<https://www.essaysauce.com/science-essays/screening-polymorphism-exon-12/> [Accessed 03-07-26].

These Science essays have been submitted to us by students in order to help you with your studies.

* This essay may have been previously published on EssaySauce.com and/or Essay.uk.com at an earlier date than indicated.