Home > Zoology essays > Relationship between ethanol, gene expression & circadian rhythms in cockroaches

Essay: Relationship between ethanol, gene expression & circadian rhythms in cockroaches

Essay details and download:

  • Subject area(s): Zoology essays
  • Reading time: 12 minutes
  • Price: Free download
  • Published: 15 October 2019*
  • Last Modified: 11 September 2024
  • File format: Text
  • Words: 3,370 (approx)
  • Number of pages: 14 (approx)

Text preview of this essay:

This page of the essay has 3,370 words.

This experiment seeks to investigate the relationship, if any, between ethanol, gene expression, and circadian rhythms in cockroaches.  An experiment on cockroaches may be shed light on humans because evolution has resulted in many organisms utilizing circadian rhythms to help them adapt to the effects of Earth’s rotation each day.  These internal “timing systems” are based on 24-hour cycles that help keep time independently of outside environmental cues.  The cycles are controlled by both the pineal gland and molecular oscillators in the suprachiasmatic nucleus (SCN) (Bollinger and Schibler, 2014).  Circadian rhythms are what all living organisms use to maintain homeostatic processes such as the sleep-wake cycle, metabolism, and hormone secretion systems. It is a mechanism that “functions to synchronize endogenous systems with the 24-hour day,” as well as controls several biological processes (i.e. body temperature, hormone secretion, sleep/wake cycle) (Pescarmona, 2010).

Circadian rhythms, also called peripheral cell autonomous circadian clocks, operate in cells throughout the body, and are driven by proteins from specific genes, such as the Period 1(PER1) gene (Kelleher, 2014). Therefore, PER1 is a common target for research on changes in circadian rhythms and other efforts to identify “clock genes.”  For example, a study using recombinant jellyfish green fluorescent protein (GFP) in mice allowed researchers to observe, in real time, the operation of the biological clock.  This study allowed researchers to gain a fundamental understanding of how the PER1 gene functions and ultimately improve predictions on how different stimulants and depressants may affect it (Kulman et al., 2000).

One depressant known to affect the Period genes is alcohol.  Disturbances in the function of core circadian clock components, including the PER1 gene in humans, are associated with alcohol disorders.  For this reason, studies aimed at uncovering the mechanisms and sites for the modulatory actions of alcohol on circadian clock genes offer possible insights into an approach to investigating the effect of ethanol, as do other prior studies (Prosser & Glass, 2015).  Some studies have found that functional mutation of either PER1 or PER2 has also caused an increase in ethanol consumption suggesting they might serve a protective role in alcohol use disorders (Gamsby et al., 2013).

These reports and observation suggest “clock genes are targets through which alcohol may alter circadian functions” (Sarkar & Phil, 2012).  Accordingly, in view of possible similarities, we chose to investigate the effects of injecting ethanol into the abdomens of orange head cockroaches in order to investigate whether the doses down-regulate PER1 mRNA expression within spinal ganglia when compared to controls. The effects will be measured by quantitative Polymerase Chain reaction, qPCR.

Methods and Materials

Subjects. In this experiment, twenty-four adult mixed sex Eublaberus Posticus cockroaches (www.AaronPauling.com).  Each cockroach was originally housed with 50-100 other cockroaches in a clear plastic cage with a filter top (48cm L x 26 cm W x 20cm H).  The cage contained 2-3 cm of damp EcoEarth compressed coconut fiber substrate (ZooMed Laboratories Inc. San Luis Obispo, CA) and each brick was hydrated with 3.5 L of water.  Additionally, the cage contained one egg crate and one petri dish/weight boat containing the cockroaches’ food source of a 5:1 mix by volume of yellow cornmeal (Quaker; Chicago, IL) to protein powder (Market Pantry; Minneapolis, MN).  The age also contained a second petri dish with 1-2 mm soil moist granules (Amazon.com) expanded with water as the water source (1:100 volume granules: water).  The temperature at which the cage was stored was between 24-30°C.  The cockroaches experienced a 12h:12h light: dark cycle with the light cycle starting at 7:00 a.m. and ending at 7:00 p.m. each day.

Experimental design: We piloted the experiment with three cockroaches four days prior to starting the class experiment.  At the beginning of the experiment, each cockroach was weighed on a scale and then marked with the appropriate number and color. The number and color for each cockroach are as follows: blue:1-5, green: 6-10, purple:11-15, pink 16-20, and orange 21-24.  Each of the 24 cockroaches was then randomly assigned into one of three groups of eight.  Group A consisted of cockroaches that were assigned to be part of the control in this experiment.  These cockroaches were not disturbed in any way nor did they receive any injections.  Group B cockroaches were the experimental group.  These cockroaches were all injected with 0.1ml of 20% ethanol (HistoPrep 100% Denatured Ethyl Alcohol) diluted with distilled water.  Group C cockroaches were the vehicle control group meaning the cockroaches were given injections of 0.1mL of distilled water.  The Tech who administered all injections was blinded to study groups. All cockroaches in groups B and C were restrained by hand and given the appropriate injections into the abdomen approximately 1 cm between the 6th and 7th sternum.  Injections occurred four hours after lights on.

Tissue Dissection: Each cockroach was anesthetized in a 500ml beaker of ice water for five minutes before starting dissections.  The cockroaches’ wings, antennae, and legs were removed prior to pinning down the cockroach.  Each cockroach was then pinned ventral side down to the dissecting dish through the head and caudal end of the abdomen.  Next, using scissors and forceps, the dorsal tergites were removed by cutting up each side of the cockroach in order to expose the abdominal cavity.  Following this, all guts and extraneous internal organs were carefully removed from the inside of the cockroach in order to provide clear access to the ventral nerve cord.  After any remaining tissue was removed, 1-2 abdominal ganglia on the ventral nerve cord were removed and placed into a1.5 ml microcentrifuge tube as to prepare for the extraction and purification of RNA.  All samples were left at -80C overnight.

RNA extraction:  The tissue was immediately homogenized in 500μl lysis buffer (Promega, Madison, WI) consisting of guanidine thiocyanate and 1-Thioglycerol and the DNA was then pipetted 7-10 times in order to shear it.  Homogenates were cleared by centrifugation for 3 minutes at 14,000 x g and then transferred to a clean tube.  Approximately 500μl of Isopropanol was then added as indicated by the tissue range input for >5mg and the solution was mixed by vortexing for five seconds.  Following this, one Minicolumn, two Collection Tubes and one Elution Tube was unpacked for sample.  Both tubes and the Minicolumn were labeled and then one Minicolumn was placed into a Collection Tube for each sample.  Next the lysate was transferred to the Minicolumn in the collection tube and it was centrifuged at 12,000-14,000 x g for one minute at 20-25C.  The Minicolumn was then removed and all liquid was discarded.  The Minicolumn was replaced, 500μl of RNA Wash Solution was added, and it was centrifuged at 12,000-14,000 x g for 20 seconds.  The Collection tube was then emptied and placed in the microcentrifuge rack.  After this, DNase I Incubation mix was prepared using 48 μl yellow core buffer, 6μl MnC12, 0.09M, and 6μl DNase.  Each of these amounts was multiplied by the number of preps, 28, for totals of 1344μl, 168μl, and 168μl respectively.  These final amounts were then used to calculate the total amount of DNase I incubation mix to be prepared. The solution was then gently pipetted to ensure it was mixed.  Next, 30μl of DNase I incubation mix was applied to the Minicolumn membrane and it was incubated at 20-25C  for 15 minutes.  After incubation, we added 200μl of Column Wash Solution, centrifuged for 15 seconds, added 500μl of RNA Wash Solution and centrifuged for 30 seconds.  The wash solutions and Collection Tube were discarded at this point.  The Minicolumn was placed into a new Collection Tube where 300μl of RNA Wash Solution was added and then centrifuged at high speed for 2 minutes.  The ReliaPrep™ Minicolumn was transferred from the Collection Tube to an Elution tube before 20μl of Nuclease-Free water was added to the Minicolumn membrane.  Both the Minicolumn and the Elution Tube were placed into the centrifuged with the Elution Tube’s lid facing toward the outside and centrifuged at 12,000-14,000 x g for 1 minute.  After centrifugation, the Minicolumn was discarded and the Elution Tube holding the purified RNA aliquots were placed on ice and stored at -80C for five days.

cDNA synthesis: The GoScript Reverse Transcription System Protocol was used for the cDNA synthesis in this experiment.  A nanodroper was used to measure the concentration of 1.0μl of RNA.  There was a very large range of concentrations with the largest being 408.1ng/μl and the smallest only 4.5ng/μl.  The original formula used for converting RNA into first-strand cDNA was 1μl of primer and 4.0μl of experimental RNA, however, any concentration greater than 100 ng/μl was diluted accordingly.  For example, RNA with a concentration of 104.9 would be plugged into the equation [RNA]x=4[100] giving an x value of 3.8.  Then that value was subtracted from the original 4.00μl of experimental RNA in order to determine how much water would be used for dilution.  The cDNA was then heated in a 70 heat block for five minutes and chilled in ice water immediately after for another five minutes.  Samples were centrifuged for 10 seconds then returned to ice until the reverse transcription mix could be added.  The reverse transcription reaction mix was prepared using 4μl GoScript™ 5X Reaction Buffer, 2μl MgCl2 (1.5-5.0mM), 1.0μl PCR Nucleotide Mix (0.5mM each Dntp)^2, 0.5μl Recombinant RNasin® Ribonuclease Inhibitor (optional), 1.0μl GoScript™ Reverse Transcriptase, and 6.5μl Nuclease-Free Water.  Each of these amounts was then multiplied by 24 samples to create overall totals of 96μl, 48μl, 24μl, 12μl, 24μl, and 156μl respectively and a final volume of 360μl of reverse transcription mix.  Prior to multiplication for the amount of samples, the final volume of reverse transcription mix for a single sample was 15μl.  Next, the 15μl of reverse transcription mix was combined with 5μl of RNA and primer mix.  The samples were annealed in a heat block at 25C for 5 minutes and then first-strand synthesis reaction was carried out at 42C for 60 minutes. The cDNA samples were stored at -20C for two days, but before proceeding with qPCR the reverse transcriptase had to be inactivated in a heat block at 70C for 15 minutes.

qPCR for Period.  In this experiment, SYBR Green based qPCR assays were used to assess levels of PER1, the gene of interest, in comparison to the housekeeping gene β-actin, in orange head cockroach ventral nerve cord for control versus experimental groups.  Each sample was run in triplicate with 2l of experimental cDNA and 18 l master mix per well.  A no reverse transcriptase (NRT) control was also used with 2 L of diluted RNA instead of cDNA. The positive control for this experiment consisted of 2 l of cDNA that was previously known to contain PER1 cDNA.  Finally, a no template control (NTC) used 20 l master mix. There was no negative control in this experiment.  The PER1 Forward Primers: GCTATTCTTCATTCTATTCATTCC and the PER1 Reverse Primers: CACCATCTCCTCAGTCTT span 3401-3510 with an Amplicon size of 110 bp. (GenBank accession # JX235363.1).

The Master Mix was prepared exactly the same for all the PCR wells, except that the wells will each have different DNA added.  Each Bio-Rad SsoAdvanced™ Universal SYBR® Green Super mix contained 10 l BioRad, 0.6 l Reverse primer (10 μM), 0.6μl Forward primer (10 μM) (Sigma, St. Louis, MO), and 6.8 l molecular biology grade water.  Approximately 18μl of the Master Mix was pipetted into the wells according to the plate layout previously constructed.  Next, 2μl cDNA was also pipetted into the appropriate wells.  The plate was then sealed and the PCR tubes were capped and centrifuged at 1000 rounds per minute for one minute in order to gather the contents at the bottom.  The plate was then placed into the thermal cycler with A1 in the upper left corner.  The lid was then closed so that the program could begin to run.

Real-time qPCR was run using the CFX Connect Thermal Cycler (BioRad; Hercules CA.  Samples began running with 40 cycles of 95C for 10 seconds, 51°C for 10s, and 72°C for 30s.  Each cycle of amplication consists of the denaturation, annealing, and elongation process.  At the end of the qPCR reaction, a melt curve analysis performed by gradually raising the temperature by 0.5 degrees every 5 seconds.  The temperature is raised from 65°C in to 95°C which melts the double stranded DNA and causes an abrupt change in fluorescence.

qPCR for -actin. In order to run qPCR for -actin, an internal control in this experiment, the same protocol was followed as for qPCR of the PER1 gene, but with a few exceptions. The main difference is the primers used for -actin (Marchal et al., 2013).  The forward primer was: TCGCACACAGTACCAATCTATGAA, the reverse primer was: CAAGTCACGACCAGCCAGATC, spanning 361-438 with an amplicon size of 78 bp (GenBank accession # JQ086312.1).  The conditions of the cycler were the same as for qPCR for PER1, except that the annealing temperature was 63.5°C rather than 72°C.

Data Analysis. The data was analyzed using the ΔCT method, using β-actin as a reference gene, which is derived from the Livak method (Livak & Schmittgen, 2001).  A one factor ANOVA was used to compare means for each group.

Results

The controls for qPCR in the present experiment included Positive Control A, Positive Control B, and a no template control.  Positive Control A produced Cq value of 22.13, and 21.82. Positive control B produced a Cq value of 21.82 and 21.56.  The no template controls did not produce a Cq value.  The experiment originally began with 24 cockroaches. Cockroaches 6,16, and 21 died before dissection and one cockroach 19 was thrown out during the RNA extraction procedure.  Furthermore, cockroach 2 did not produce enough cDNA to continue with the experiment so no β-actin Cq was given.  As a result, the difference in levels of cDNA for cockroach two could not be analyzed or included in data.  For Group A, as indicated in table 1, the mean of units per mRNA expression was 36489970.2857 +- SEM 17469379.08925 (n=7).  Group B, as indicated in table 1, had a mean of 128855788.60000 +- SEM 76557655.47290 per mRNA expression (n=5).  As for Group C, as indicated in table 1, the mean was 5980882.1429 +- SEM 45585848.16996 per mRNA expression (n=7).  The experimental group, Group C, produced the largest mean and the largest standard mean of error.  The mean indicates the difference between the β-actin and PER1 gene expression.  Group A, the negative control, produced the smallest mean and smallest standard error of mean.  The ANOVA run between all three groups indicated that results there was no statistically significant difference between groups with a p value of p=0.406, shown in table 1.

While the means of Group A and Group C differed, the ANOVA run between all three groups did not indicate any significant difference.  Both the one-factor ANOVA for β-actin and the one-factor ANOVA for PER1 showed no statistical significance between groups for their respective gene.  Generally speaking, results did show an interesting trend suggesting reason to continue investigating or re-investigate the effect of ethanol on PER1 mRNA expression.  However, even if statistically significant results were found, they could not be considered reliable due to the presence of DNA in the NRTs.

The conventional Polymerase Chain Reaction (PCR) is a powerful technique in molecular biology used to create, or “amplify”, potentially millions of copies of a particular section of DNA.  This allows researchers to test for the presence of a specific gene of interest using “sequence-specific oligonucleotides, heat-stable DNA polymerase, and thermal cycling” (Marchal et al., 2013).  In traditional PCR, the detection and measurement of DNA is performed at end of the procedure after the last PCR cycle.  It also requires further post-PCR analysis. In order to address a need for more robust quantification, qPCR, also known as real-time PCR, was developed. In qPCR, the DNA is measured during the procedure at each cycle via fluorescent dyes.  This real-time monitoring allows researchers to accurately determine the initial quantity of the target as well as measure changes in fluorescence over the course of the whole reaction.

As a result of this advantages, real-time PCR has become a popular method for gene expression analysis and measurement of mRNA.  In order to obtain accurate expression of specific genes, it is necessary to use reliable internal control gene products that allow the normalization of expression levels between experiments.  Typically, expression products from housekeeping genes are used, but it is still necessary to run the gene to ensure it provides consistent expression under desired experimental conditions.  This is why we ran a second qPCR reaction for β-actin as well as running one using PER primers. β-actin provided a reliable reference for comparing expression levels from the experimental gene product.  Using β-actin as an active reference, allows the quantification of mRNA to be normalized for differences in the total amount of RNA added to each reaction.  Additionally, the degradation level of an RNA sample has a direct effect on the amount of mRNA that will be converted into cDNA and ultimately quantified.

During the process of denaturation, the fluorescent dye SYBR green, passed a threshold at which it is able to be detected over the background.  This point is called the threshold cycle value (CT) or the quantification cycle value (Cq).  As the Cq value gets lower, the original concentration of the gene of interest meaning is higher.  For example, if sample A were to have a Cq value of 20 and sample B were to have a Cq value of 22 for gene X, it would mean that sample A contains a larger amount of the gene of interest than sample B does.

In addition to the unknown experimental samples, several other controls should be used. A positive control uses cDNA previously shown to contain the gene of interest (PER1).  This control confirmed that the amplified gene in the cDNA was in fact PER1.  A negative control uses cDNA that does not contain the gene of interest.  This experiment did not use a negative control as it is hard to find cDNA that does not contain PER1.  Another control was the no template control (NTC), which controlled for general DNA contamination.  Specifically, it monitored contamination of master mix that could result in false-positives within results.  Finally, a no reverse transcription control (NRT) was used to control for genomic DNA contamination.  In the present experiment, DNase I was used in order to degrade genomic DNA before performing reverse transcription.  However, the NRTs still had DNA in it, which proved to be a major flaw causing the experimental results to be invalidated.  This contamination most likely occurred during RNA isolation which would mean essentially restarting the experiment with more caution in order to get clean samples.

Overall, the experimental design behind this experiment was good, but the execution consisted of several issues and limitations.  The major limitation would be that roughly 20 different people performed each procedure.  Ideally, one person would execute all procedures for every sample to maintain consistency.  Additionally, each step had several days-in-between.  Over time, there may have been some degradation of samples before qPCR could be completed.  Furthermore, the cockroach injections occurred four hours after lights, which is the middle of their inactive phase. It may have been more effective to perform injections when they switched cycles to avoid disruption.  A positive aspect in this experiment was the inclusion of a negative control group. This group accounted for confounding variables such as the sleep disruption and injection trauma experienced by the experimental group.  Future studies may seek to address questions such as: what role does a circadian clock gene such as PER1 play in the etiology of alcohol abuse? They may even investigate how, or if, ethanol modulates the SCN circadian clock.

In general, qPCR has opened the door for more accurate and informative explorations of specific genes of interest.  Although the present experiment did not yield significant results, there is still reason to investigate the effects of ethanol on period gene expression.  The complex interaction between alcohol and the body’s circadian rhythm is a subject of study due to its potential implications on alcohol research.  Addicts typically have disrupted rhythms suggesting that abnormalities in their internal clock may be a contributing factor to increased vulnerability for addiction and relapse (Falcon & McClung, 2008).  Additionally, research has found the PER1 gene regulates alcohol drinking behavior during stress conditions which suggests it may hold potential answers for underlying neurobiological mechanisms (Dong et al., 2011).  In general, by having a better understanding of alcohol’s effects on the internal clock, scientists may be better equipped to design medications and interventions for alcohol dependence (Wasielewski & Holloway, 2016).

About this essay:

If you use part of this page in your own work, you need to provide a citation, as follows:

Essay Sauce, Relationship between ethanol, gene expression & circadian rhythms in cockroaches. Available from:<https://www.essaysauce.com/zoology-essays/2017-12-1-1512105751/> [Accessed 10-06-26].

These Zoology essays have been submitted to us by students in order to help you with your studies.

* This essay may have been previously published on EssaySauce.com and/or Essay.uk.com at an earlier date than indicated.