Home > Science essays > Polymerase chain reaction

Essay: Polymerase chain reaction

Essay details and download:

  • Subject area(s): Science essays
  • Reading time: 7 minutes
  • Price: Free download
  • Published: 16 November 2017*
  • Last Modified: 23 July 2024
  • File format: Text
  • Words: 1,873 (approx)
  • Number of pages: 8 (approx)

Text preview of this essay:

This page of the essay has 1,873 words.

Polymerase chain reaction (PCR) was developed in the mid-1980s and is a critical invention in molecular biology. The goal of PCR is to amplify a specific target DNA sequence from a whole genomic DNA. Many other methods have been developed from PCR modifications including: target specific nucleic acid, probe specific for target sequence, or a signal to detect a target sequence. PCR involves doubling the target strand exponentially by repeating three major steps. The first step is denaturation, in which the double-stranded DNA is divided into two single strands of DNA. The second step is annealing and occurs when primers attach to the two single strands of target DNA. The last step in the process is extension. The primers elongate in the 5’ to 3’ direction using DNA polymerase. This is the step that generates millions of copies of the original DNA by doubling. PCR is convenient and beneficial for detecting pathogenic bacteria whether or not there are live or intact cells. Therefore, detection can still occur if the bacteria die due to improper storage conditions or antibiotic treatment. PCR is highly sensitive and specific and is used extensively in the diagnosis and surveillance of pathogenic bacteria.
 
Quantitative real-time polymerase chain reaction, or qPCR, involves the combination of detecting and amplifying in one step using fluorescent dyes. Two types of detection systems, specific and non-specific, use fluorescent dyes. Non-specific detection systems are fairly inexpensive, but bind to any double-stranded DNA to emit fluorescence. This may result in an increased amount of false-positives. On the other hand, specific detection methods are rather expensive and calls for specific probe designs for the target DNA. The probes use fluorescent resonant energy transfer in which a signal only occurs when the probe comes in contact with the specific target. In this validation study, the gene targets and sequence of primers and probes used in PCR reactions are used to detect and characterize Neisseria meningitidis, Haemophilus influenza, and Streptococcus pneumonia. The species-specific assays will be run first. Following the receipt of a positive specimen, the proper serotypic assay will be run.

DNA can be extracted from clinical specimens such as blood, cerebrospinal fluid, and bacterial isolates. N. meningitidis can be detected by targeting two genes: ctrA and sodC. CtrA is the capsule transport to sell surface gene ad=and is located within the capsule locus. There are, however, 16% of meningococci that lack the ctrA gene or a capsule. Therefore, as assay was developed to detect all meningococci whether or not it has a capsule. This is the sodC assay and it targets the copper, zing superoxide dismutase gene and is not usually linked to the capsule locus. SodC detects both encapsulated and non-encapsulated meningococci that do not contain ctrA. H. influenza, on the other hand, utilizes the protein D gene, hpd. It is a lipoprotein found on the surface of all capsulated and non-encapsulated strains of H. influenza. Among the assays for S. pneumonia is the autolysin, lytA gene. The lytA gene is very specific to S. pneumonia and best separates it from other genotypically similar species such as S. mitis, S. oralis, and s. pseudopneumoniae. Its high specificity will rarely lead to false-positive or false-negatives.

During this research, we will validate new real-time PCR assays for more sensitive methods to detect meningococcal pathogens using sodC or ctrA, hpd, and lytA. Although PCR serotyping is needed for further typing, time did not permit further testing in the allotted timeframe.

II. Materials and Methods

Equipment:

Microcentrifuge (Eppendorf 5424 Hamburg, Germany)

Accu Block Digital Dry Bath (Labnet International, Inc Woodbridge, NJ)

Vortexer

pH meter

Freezer

Refrigerator

Turbidity meter

Plate centrifuge (Fisher-Scientific)

PCR Hood (C.B.S. Scientific Co. Model P-036-02, Del Mar, CA)

7500 Fast Dx Real-Time PCR Instrument (Applied Biosystems)

7500 Fast System with 21CFR Part 11 Software

Consumables:

10% bleach (10:1, water: concentrated bleach)

70% ethanol

1.7 ml microcentrifuge tubes (sterile, Avant: lot- 392200-W22998)

1 set of micropipettors (1-10 μl, 2-20 μl, 20-200 μl, and 100-1000 μl)

Pre-sterilized filter tips (10 μl, 20 μl, 200 μl, and 1000 μl)

MicroAmp Fast Optical 96-well Reaction plate with Barcode (Applied Biosystems, lot-4346906)

MicroAmp optical 8 cap strips (lot- P25A9 QA42)

Reagents:

TE buffer (10 mM Tris HCl, pH 8.0, 1 mM EDTA)

Lysostaphin (lot-011116, exp 011117)

0.85% NaCL (lot-070616, exp 070617)

HyClone HyPure Molecular Grade Water (lot-AB216652, exp 0518)

HotStarTaq Master Mix Kit containing dNTP, DNA polymerase, and reference dye (Qiagen, Hilden, Germany)

Working concentration of Neisseria meningitides, Haemophilus influenza, and Streptococcus pneumonia for primers and dual-labeled hydrolysis probes containing 5’ fluorophore and 3’ internal quencher

Preparing Reagent solutions

EDTA, 0.1 M, pH 8.0 (100ml)

1. Dissolve 3.7 g EDTA in 70 ml distilled deionized H2O (ddH2O).

2. Adjust pH to 8.0 with 10 M NaOH.

3. Add ddH2O to 100 ml.

4. Autoclave at 121°C for 20 minutes.

5. Store and room temperature

Tris-HCl 0.1 M, pH 8.0

1. Dissolve 1.2 g Tris base in 80 ml ddH2O.

2. Adjust to pH 8.0 with concentrated HCl.

3. Mix and add ddH2O to 100 ml.

4. Autoclave at 121°C for 20 minutes.

5. Store at room temperature.

TE Buffer (10mM Tris HCl, pH 8.0, 1 mM EDTA)

1. Add 10 ml of 0.1 M Tris-HCl, pH 8.0

2. Add 1 ml of 0.1 M EDTA, pH 8.0

3. Add sterile ddH2O to 100 ml and mix well

4. Store at room temperature

Fast preparation of DNA template from clinical isolates

A. N. meningitides and H. influenza (gram-negative)

1. Dispense 1.0 ml of TE buffer into labeled ? tubes.

2. Harvest colonies from 18-24 hour pure cultures of H. influenza or N. meningitides using a sterile polyester swab and swirl in the TE buffer to make a 0.1 McFarland suspension.

3. Transfer suspension into 1.7 ml microcentrifuge tubes

4. Vortex briefly and boil suspension at 100°C for 10 minutes

5. Proceed immediately with PCR or store at -20°C (may be stored at 4°C for a short period of time).

B. S. pneumonia (gram-positive)

1. Dispense 1.0 ml of 0.85% NaCl into labeled ? tubes.

2. Harvest colonies from 18-24 hour pure cultures of S. pneumonia using a polyester swab and swirl in the 0.85% NaCl to make a 0.1 McFarland suspension.

3. Transfer into 1.7 ml microcentrifuge tubes

4. Vortex briefly and incubate at 70°C for 15 minutes.

5. Microcentrifuge at 12,000 x g for 2 minutes and remove supernatant.

6. Re-suspend in 50 μL of TE Buffer and add 10 μL of lysostaphin

7. Incubate at 37 °C for 30 minutes up to 18 hours.

8. Heat-inactivate the enzymes in the suspension by boiling at 100 °C for 10 minutes.

9. Microcentrifuge at 12,000 x g for 4 minutes and remove supernatant for use as DNA template

6. Proceed immediately with PCR or store at -20 °C (may be stored at 4°C for a short period of time).

Preparation of Primers and Probes

Table 1 lists the nucleotide sequences, working concentrations, and chemical modifications of the primers and probes for N. meningitidis, H. influenza, and S. pneumonia species detection targeting the ctrA or SodC, hpd, and lytA genes, respectively. Primers and probes were diluted from concentrated stocks to working stocks using as demonstrated in Table 2. These primers and probes were stored at 4-8°C (may be stored at -20 °C if used less frequently.

Target Primer or Probe Name Real-time Primers and Probes Nucleotide Sequence (5’ to 3’) Working Stock Conc (μM) Final Conc (μM) Suggested Probe Modifications

N. meningitidis

ctrA F753 TGTGTTCCGCTATACGCCATT 3.75 300

R846 Gccatattcacacgatatacc 11.25 900

Pb820i AACCTTGAGCAA”T”CCATTTATCCTGACGTTCT 1.25 100 5’ FAM, BHQ1 on “T”, 3’ SpC6

sodC F351 GCACACTTAGGTGATTTACCTGCAT 3.75 300

R478 CCACCCGTGTGGATCATAATAGA 7.5 600

Pb387 CATGATGGCACAGCAACAAATCCTGTTT 1.25 100 5’ FAM, 3’ BHQ1

H. influenzae

Hpd hpdF822 GGTTAAATATGCCGATGGTGTTG 1.25 100

HPDR952 TGCATCTTTACGCACGGTGTA 3.75 300

Pb896i TTGTGTACACTCCGT”T
”GGTAAAAGAACTTGCAC 1.25 100 5’ FAM, BHQ1 on “T”, 3’ SpC6

S. pneumoniae

lytA F373 ACGCAATCTAGCAGATGAAGCA 2.5 200

R424 TCGTGCGTTTTAATTCCAGCT 2.5 200

Pb400i TGCCGAAAACGC”T”TGATACAGGGAG 2.5 200 5’ FAM, BHQ1 on “T”, 3’ SpC6

Table 1. Primers and Probes for detection of bacterial meningitis pathogens

Working

Concentrtion (μM) To make working stock

Neisseria meningitidis

ctrA F753 3.75 18.75μL stock to 481.25 μL mgH2O

R846 11.25 56.25μL stock to 443.75 μL mgH2O

Pb820i 1.25 6.25 μL stock to 493.75 μL mgH2O

sodC F351 3.75 18.75μL stock to 481.25 μL mgH2O

R478 7.5 37.5 μL stock to 462.5 μL mgH2O

Pb387 1.25 6.25 μL stock to 493.75 μL mgH2O

Haemophilus influenza

Hpd F822 1.25 6.25 μL stock to 493.75 μL mgH2O

R952 3.75 18.75μL stock to 481.25 μL mgH2O

Pb896i 1.25 6.25 μL stock to 493.75 μL mgH2O

Streptococcus pneumonia

lytA F373 2.5 12.5 μL stock to 487.5 μL mgH2O

R424 2.5 12.5 μL stock to 487.5 μL mgH2O

Pb400i 2.5 12.5 μL stock to 487.5 μL mgH2O

Table 2. Primer and probe working stock from working concentration

Performing real-time PCR

1. Fill out a PCR template worksheet as demonstrated in Figure 1.

2. Turn on the real-time PCR machine to allow the lamp to warm-up.

3. Remove DNA preparations and positive control DNA from the -20 °C or 4 °C to the dirty room or hood to thaw.

4. Remove laboratory coat and discard gloves. Enter the clean workspace and put on clean laboratory coat and gloves.

5. In the clean room, gather reagents: HotStar commercial master mix, working stock primers and probes, and PCR grade water. If primers and probes were frozen, allow to thaw completely before use.

6. Vortex or flick each tube prior to use. Make one master mix per primer and probe set. The master mix per one sample should contain:

12.5 μL of master mix

4.5 μL of sterile, PCR-grade water

2 μL of forward primer

2 μL of reverse primer

2 μL or probe

23 μL total before adding 2 μL of DNA

When calculating master mix total volume, add enough master mix reagents for 2 extra reactions to make sure there is enough mix.

7. Pipette 23 μL of the prepared master mix into each appropriate well a 96-well plate, according to the plate template worksheet.

8. Add 2 μL of PCR-grade water to the clean NTC wells and then cap only that row until ready to add the DNA samples in the dirty room. May alternately cover the plates with a one-time adhesive film.

9. Wipe down the clean workspace area and used micropipettes with 10% bleach, then 70% ethanol and turn on UV light for one hour, if available.

10. Remove laboratory coat and discard gloves.

11. Put on a fresh pair of gloves and carefully transport the plate to the dirty room or hood.

12. According to the DNA template worksheet, add 2 μL of DNA to the appropriate well. Change gloves frequently between samples.

13. Cap columns of wells as you go. May use a roller tool to secure caps tightly.

14. Wipe down the workspace with 10% bleach, then 70% ethanol and turn on the UV light for one hour, if available.

15. Remove the laboratory coat and discard gloves.

16. Observe the bottom of the plate to ensure there are not any bubbles at the bottom of the wells. If there are, gently flick the well to allow the bubble to rise to the top.

17. If possible, spin the plate at 500 x g for a few seconds to bring down any droplets and to mix.

18. Observe the wells from the bottom of the plate once again to ensure there are not any bubbles at the bottom of the wells that could potentially give a false negative.

19. Transport the plate directly to and place it in the PCR machine.

Operating the PCR Instrument

1. Once in the PCR application, click “create a new document”.

2. Change the run mode to “standard”. Click “next”

3. Select the appropriate target for the appropriate wells according to the DNA template worksheet.

4. Change the reference dye to “none”. Click “Finish”

5. Once the system initializes, label each well with the appropriate name or sample number.

6. Click on the instrument tab to set the cycle parameters.

7. The cycle parameters set for the primers and probes given in the table are:

1 cycle of 50 °C for 2 minutes

1 cycle of 95 °C for 10 minutes

50 cycles of 95 °C for 15 seconds + 60 °C for 1 minute

8. Turn off the machine lamp when the assay is complete.

III. Data

About this essay:

If you use part of this page in your own work, you need to provide a citation, as follows:

Essay Sauce, Polymerase chain reaction. Available from:<https://www.essaysauce.com/science-essays/polymerase-chain-reaction/> [Accessed 10-05-26].

These Science essays have been submitted to us by students in order to help you with your studies.

* This essay may have been previously published on EssaySauce.com and/or Essay.uk.com at an earlier date than indicated.